Transcript asmbl_3412

Sequence
Transcript Sequence for observation asmbl_3412 of TGE0012472:
GCCCAAGAAGAGTTACAAACAAACAAATAAAAAACAGAGAGAGATGGACCTGCCATTGCAGTGGCTCCTGACACGTGAGTCCAGTCTCTTTATAGGTTCCGGTTAGCATACCGGTGTCCCCCTGCCATCCCTCTCTCTCTGCAGGCCAAGAGGTGCACGGTGATCGGAGGCTCTGGGTTTCTGGGACAGCACATGGTGGAACAGTTGCTGGCAAGAGGCTATGCTGTCAATGTATTTGATATGCGACAGGGGTTCGACAATCCCCAGGTGAAGTTCTTTATGGGCGACCTCTGCAACCAACAGGACTTGTACCCAGCTGTGAAAGGTGTGAGTACAGTTTTCCACTGTGCATCACCCTCCCCATCAAGTAACAACAAGGAACTCTTTTACACAGTCAATTACATTGGCACCAAGAATGTCATCGAGACTTGCAAACAGGCTGGGGTTCAGAAACTCATTTTAACCAGCAGTGCTAGTGTTATCTTCGAAGGTGTCGACATCAAGAATGGCACAGAAGACCTTCCATATGCCATGAAACCCATTGACTACTACACAGAAACAAAGATCTTACAGGAGAGAGAGGTCCTGGTCGCGAACAATCCCGAGAAGAATTTTTTCACCACAGCTATCCGCCCCCATGGCATTTTCGGCCCAAGGGACCCCCAGCTGGTCCCCACCCTCATTGAGGCAGCCAAAAAAGGCATGATGAAGTTTATCATTGGAAACGGAGAGAACTTGGTGGACTTTACCTTCGTGGACAACGTGGTCCACGGACACATTCTGGCCGCAGAGCACCTTTCACAAGACACGGCCTTGGCTGGCAAGGCGTTCCACATCACCAATGACGAGCCCATCCCTTTCTGGACATTCCTGTCGCGCATCCTGACAGGCCTCAATTACGAGGCCCCTAAGTACTATATACCCTACTGGGTGGCCTACTACCTGGCCCTCCTGCTGTCCCTCCTGGTGACAGTGCTCAGCCCTGTTGTACAGCTGAAGCCCACTTTTACACCCATGCGTGTCGCACTGGCTGGCACATCGCACTATTACAGCTGCGAGAAAGCCAAAAAAGCCATGGGCTACCAGCCACTGGTCACTATGGACGACGCCGTGGAGAGAACTGTGCAGAGCTTCCACCACCTGCGCAGAGTCGAGTGAGGTCCCCGAGATGGGGCCCCCTCGCCGTGCTCCCCCATGGATAGCTCTCTCTGTGGGGGACCAATAAACTAACCTCCTTTAAGTGA