Transcript asmbl_33426

Sequence
Transcript Sequence for observation asmbl_33426 of TGE0004902:
TGCTCCGCGCTAGGCCAGTGCCATGGCGGTAGTGGCGGCCCTTCTGCGCGGCTGTGTCCGCCGGTGCAGCCCCCTGCTTCGGCTACAGATGCAGGAAATAAGTTATGTAAAACGAAGTTATGTATCAAAACCCACTTTGAATGAAGTGGTAATAGTAAGTGCTATAAGAACACCCATTGGATCCTTTCTAGGCAGCCTTTCCTCCCTGCCAACCACTAAGCTTGGTTCCATTGCAATTCAGGGAGCCATTGAAAAGGCAGGGATTCCAAAAGAAGAAGTGAAAGAAGCATACATGGGTAATGTTCTACAAGGAGGTGAAGGACAGGCGCCTACTAGGCAAGCAGTACTAGGTGCAGGCTTACCAGTATCTATTCCATGTACCACTATAAACAAAGTGTGTGCCTCAGGAATGAAAGCCATTATGATGGCTTCTCAGAATCTTATGTGTGGACATCAGGATGTGATGGTGGCAGGTGGGATGGAGAGCATGTCCAACACTCCCTATGTAATGAACAGAGGAGCAACACCGTATGGTGGGGTAAAGCTTGAAGATTCAATAGTAAAAGATGGGCTAACCGACGTCTACAATAAAATTCATATGGGCAACTGTGCTGAGAATACGGCAAAGAAGCTGAATATTGCACGAGATGAACAGGATACTTATGCTATTAACTCCTACACCAGAAGTAAATCAGCATGGGAAGCTGGAAAATTTGGAAATGAAGTTATTCCTGTCACAATTACAGTAAGAGGCAAACCAGATGTAGTGGTGAAAGAAGATGAAGAATATAAACGTGTTGATTTCACTAAAGTTCCAAAACTGAAGACAGTATTCCAAAAAGAAAACGGTACAGTAACAGCTGCCAATGCCAGCACACTGAATGATGGAGCAGCTGCTATGGTTCTGATGACTGCAGATGCAGCCAAGCGACTCAACGTTAAACCACTGGCAAGAATAGCAGCATTTGCTGATGCTGCTGTAGACCCTATTGATTTTCCAATTGCACCTGCATATGCTGTACCTAAGGTTCTTAAAGATGCAGGATTGAAAAAAGAAGATATTACAATGTGGGAAGTAAATGAAGCCTTTAGTCTCGTTGTACTAGCAAACATTAAAATGCTGGAGATTGATCCTCAAAAAGTGAATATCCATGGAGGAGCTGTTTCTCTGGGACATCCAATTGGGATGTCTGGAGCCAGGATTGTCATTCATTTGGTTCATGCTTTGAAGCAAGGAGAATATGGTCTTGCCAGTATTTGCAATGGAGGAGGAGGTGCTTCTGCCATGCTGATCCAGAAGCTGTAAGACAACAACCTCTGTTGTCTAAGGAGACAATCCTATGTGGCTAGAAAGGCCTGCTGTAATCAGTGTGACTACCTTGGGTCAGCTTGTTCTCAAAATAACATTACGTTTTTAAATTATTTTCTATTTTAACTTTTTTTATAAGGGGAAAAGATCAAATCTCAAAACCTTTTGAAATTACAAATAAATTTTTTCTTCTACTTTAAA