Transcript asmbl_33368

Sequence
Transcript Sequence for observation asmbl_33368 of TGE0004893:
CTCTTTTGCTTAGGCCGGTGGTGTTGGCAGGATGGGCAAGTGTCGCGGTCTTCGTACTGCAAGGAAGCTCCGAAGCCATCGGCGAGATCAGAAGTGGCATGATAAACAGTACAAGAAAGCCCATTTGGGCACAGCCCTGAAAGCCAACCCTTTTGGAGGCGCATCCCATGCCAAGGGAATTGTGCTGGAAAAAGTAGGGGTTGAAGCCAAACAACCAAATTCTGCCATCAGGAAGTGTGTCAGAGTCCAGCTCATCAAGAATGGCAAAAAGATCACAGCCTTTGTACCCAATGATGGTTGTTTGAATTTTATTGAGGAAAATGATGAAGTTCTGGTTGCTGGATTTGGTCGCAAAGGTCATGCTGTTGGTGACATTCCTGGAGTCCGCTTTAAGGTTGTCAAAGTAGCCAATGTGTCTCTCTTGGCTTTATACAAAGGCAAGAAGGAAAGACCAAGATCATAAGTTTCAATGGTGAAAACACAGTAATAATAAATTTTCATATGCCAAAAATAGGTTGTGTCTTATTTTCTTTACCACAGAGATATATGCTTTACCAATTTTAGGAGATTTGGAAAATATTTGATTCAGAGTTCTCTAGAGTAAATGCGATTCACAGTAAAGTTTATCCCCTGCATGTAATAAAATAACAGTAAATCTAGAAGAAATA