Transcript asmbl_32293

Sequence
Transcript Sequence for observation asmbl_32293 of TGE0004845:
TTTAAATCTGAGGCAAGGCCCTGCATCTCCCAGCGTGCTGCAGAGGAACGGCTGTTGATCTGTGTTGAATTCAGGTCCCCGGCTTGTCGGGGGCTCGAGTTCTCGGCTTCTCTCCTCTGAGCTGCTACCTGTTGAAGAGGAAGCCATGGCGTTCCGGGTCACCAGGAACACGAAAATTAATGCTGAAAATAAGGTGAAGATCAATATGGCAGGCGCAAAGCGCGTGCCTGTGTCCACTGCTGCAGCCTCCAAGCCGGGCCTGAGACCAAGAACCGCCCTTGGAGACATCGGTAACAAAGTCAGTGAACAGCCACAGGCCAAATTACCTCTGAAAAAGGAAGCAAAAACTTTAGCTGCTGGAAAAGTTATTGCTAAAAAAGTACCTAAACCTCTGGAAAAGGCACTGGAGCCTGTGCCTGAGCCTGCGCAGGAGCCTGTGCCGGAGCCTGCATCAGAGCCAGAACCTGAGTCTGTTAACAAAGAAGAAAAACTTTCTCCTGAGCCTATTGTGGTTGATACTCCCTCTCCAAGCCCAATGGAAACGTCTGGATGTGCCCCTGCAGAAGAATATCTGTGTCAGGCTTTCTCTGATGTAATTCTTGCAGTGAACGATGTGGATGCAGAAGATGGAGCTGATCCAAACCTTTGTAGTGAATATGTAAAAGATATCTATGCTTATCTGAGGCAACTTGAGGAAGAGCAAGCAGTCAGACCAAAATACTTACTGGGTCGTGAAGTCACTGGAAACATGAGAGCCATCCTAATTGATTGGCTAGTGCAAGTTCAAATGAAATTCAGATTACTGCAGGAGACCATGTACATGACTGTTTCCATTATTGATCGGTTCATGCAGAATAATTGTGTTCCCAAGAAGATGCTGCAGCTGGTTGGTGTCACTGCCATGTTTATTGCAAGCAAATATGAAGAAATGTACCCTCCAGAAATCGGTGACTTTGCTTTTGTGACTGACAACACTTACACTAAGCTCCAAATCAGACAGATGGAAATGAAGATTCTAAGAGCTTTAAATTTTAGTCTGGGTCGCCCTCTACCCCTGCATTTCCTTCGGAGAGCATCTAAGATTGGAGAGGTTGATGTGGAGCAACATACTTTGGCCAAATACTTGATGGAACTAACGATGTTGGACTATGATATGGTGCACTTTTCTCCTTCTCAGATCGCAGCGGGAGCTTTTTGTTTAGCACTGAAAATTCTCGATAATGGTGAATGGACACTAACTCTACAGCATTACCTGTCATATACTGAAGAATCCCTTCTTCTTGTTATGCAACACCTGGCTAAGAATATAGTCATGGTGAATCGTGGACTTACAAAGCACATGACTATCAAGAACAAGTATGCCACAGCTAAGCATGCTAAGATCAGCACTCTTGCACAGCTGAATTCTGCACTAGTTCAAGATCTGGCCAAGGCTGTGGCAAAAGTGTAACTTGTGAAATTGAGTTGGAGTACTGTAATGATCTGCAAATAAAATTGGCACCATGTGCTATCTGTATATATTACATGTTACATTTATTTACTTTTAATAAAGTTGTGGACCTTTTTACTTCTTACCTTAACTCATTTGAATGTGGCCACTTCCTGCTCTTGGGGAACCCTAAAAGTAGCCTTAAAGATATGCTAGGGAATATAGAGTATTAAAAAAAGCGCTTTCAGTTAAACTAGGGACCCAACTAATATATATAATTGTTGCTTATATGATTCTTGTTTTATATACCTACCTGGATTTTGCTTTATAAATAGGAATTACTAAGGTTATGAAGGCATTTAAAACCCTTACCTTCCATAGGGCATACTGCATGTAAGCCTAGTCATCTTGGAGCATCTGCTGCCTTGTTCTACTTAAGTAAAAGTCTGCCACCTCATCCCTAGTCCGCCATTTTCTGTTTCTTCTGGTGTTTGCTGCCATAAATTCTAAGTAATCTACTTTTACCACTATTTCTTAAATTATCAACTTTAGTATCAACTTTTTCACTTGGAAAAATGACTTTATATTCTAAACATACTTTACTTTTTCTTTATTAGTTGAGAAAATAAAACAGACTCCTCAAAACATACCAAAGTATCTTAAAAAGTTTATTTTACCTCTCCCCGCAACTCTCCTACATCTCCACGCCCTCGACCTGAAGATGTCAACAGTTTGAGATGTAGCCTTCCATGACTTCTATAAACATAGATGTGCATAGATATAAATTGTCATGGAGATTTTAAAACATAAGATTTTTCTACATGCTTAGCAATTCCTTTCAATATGTATAGACATCTGTTTTAGGGTATTACGTTCCAGAGTATAATGTATTCAGTCATTCAATTGACATTTGGATGGCTTTTTTCTTTGCCCCTAAAGACAATGCTGTTTAAATATCATTAAGTATCATGTTGGTTTTTTGGGGGTTTTTTTTACATAAATTGGGTTCTCCAAAGGGTATGTGTGTTCTCACTTAAAGCAGGTCCTGTCAAATGACTTTCTCAGTGTCATCAGCAATGTACAAAAGTGCTGGTTTTCTCTGCAGTTTTGTCAAAACTAAAGATAATCTCTTTAATTTCTGTGAATTTGGGAATTCTACCTTGTTTGCTGTTTTAATGTATACTCCTAATGATTACTTGAATAAATTTTTGTTGTCTACTAACTTTTCAATGTGTAAGCCTTTCCC