Transcript asmbl_31643

Sequence
Transcript Sequence for observation asmbl_31643 of TGE0004810:
CTATGTCCAGTCTAGTATTTCTCATATAACTTTTTTTTGTTGTTATTGATACATACATCAGATAAAATCTGATGAAAGCTAGGGACCGTCTTACAAAATGCACATGCATACAATTCTGCATTTTATTTCAGGAGTTACTGGATCCTGAAGACCATCCCTGGATCTCGGGTTAAAAATCTGTTCTAATCTGAACCGTGGGAAGAAAGGGTCCTTGGTCGGCGGTATTCCCACCTGAAGGACATGATGTTTTCCAAACTAGCACATTTCCAGACCGTTGCCGTGCTGCGTCGAGGAGTTCACTCTTCAGTGGCTTCTGCTACATCCGTTGCGACTAAAAAAACAGTCCAAGGCCCTCTATCCTCTGATTACGTTTTTGAAAGGGAATCGAAATATGGCGCACACAACTACCATCCCTTACCTGTAGCCCTGGAGAGAGGAAAAGGTATCTACCTGTGGGATGTAGAAGGCAGAAAATATTTTGACTTCTTGAGTGCTTACAGTGCTGTCAACCAAGGGCATTGTCACCCAAAGATTGTGAATGCTCTGAAAAGTCAGGCAGACAAACTGACCTTGACATCTAGGGCATTCTATAATGATGTACTTGGTGAATATGAAGAGTATATTACTAAACTTTTCAACTATCACAAAGTTCTTCCTATGAATACAGGAGTGGAGGCTGGAGAGACTGCTTGCAAGCTTGCTCGTAGATGGGGATATACCGTTAAGGGTATTCCGAAATACAAAGCAAAGATCGTTTTTGCAGCTGGAAACTTTTGGGGTAGAACTATGTCTGCTATCTCCAGTTCCACAGACCCAAACAGTTACGAAGGTTTTGGACCATTTATGCCAGGTTTTGAAATCATTCCATATAATGATCTGCCCGCTCTTGAGCGTGTTCTCCAGGACCCGAACATCGCCGCATTCATGGTGGAGCCCGTTCAGGGCGAAGCGGGCGTCATTGTGCCAGACCCGGGCTACCTGACAGGCATCCGTGAGCTCTGCACCCGGCACCAGGTTCTGTTTATTGCTGATGAAATACAGACAGGATTGGCCAGAACTGGTAAATGGCTGGCCGTCGATCATGAAAATGTCAGACCTGATATAGTCCTTCTTGGAAAGGCGCTTTCTGGTGGCTTATACCCTGTGTCCGCAGTACTGTGTGATGATGAAATAATGCTGACCATCAAACCAGGGGAGCATGGGTCAACGTTTGGTGGCAACCCGCTGGGCTGCCGAGTGGCCATGGCAGCCCTCGAGGTTTTGGAAGAAGAAAACCTTGTTGAAAATGCAGATAAAATGGGTACCATCTTGAGAAACGAACTCATGAAGCTACCATCTGATATCGTAACTGCTGTAAGAGGGAAAGGATTATTAAACGCTATTGTTATTAGAGAAACCAAAGATTACGATGCTTGGAAGGTGTGTCTGCGACTTCGAGATAATGGACTTCTGGCCAAGCCAACCCACGGCGACATTATCAGGTTTGCACCTCCGCTTGTGATCAAGGAAGACGAGGTTCGGGAGTCCATGGAAATCATTAACAAGACCATCTTGTCTTTCTGAGGGTTGCGACTGTTTTCGGCGGTGCCTGTGAGTCAGCTGGAGACAGGCAGACAGTTCCTTGAAGTCCTGTAAAAAGCTTCTGCATTTTTGTGTGTGATGCAGGCACATTCCACTCCCTGTGTCTTCAAGGACTTATTTTTTAATATACATATTTTTCAGTTCATACATAATAGAGTGACATTTATAATCGTGCAGTATGCCATTTAACATAACTGTAAGAGAATGTAATGACATCTATATTCGATTGTTTTTGTGTACTTGTGTACTTTCTGAAGTGAAATGCATCTATTTGTCTGTCTGTAGGCAGCCTTACAATCAAGCCCCATATAACTTATATATGTTTTTATAATTTCTGGTGTAAATGTTTTATATTTGAAAAAGTTATATGGGGTTTTACATAAAAGACTTCTTTAACCTTATGAAGCTGAATTATAATCATTGAATTTTAGGAAGGTTAAGCTTATATAAAACACTAGATTTAAATAAACTTCATATTGGCCAACATCAGAATATATTCCATGAGTGTCATTATTTTGAATTAATAATTAATATTTAACATTCCCAAATTATTTT