Transcript asmbl_31641

Sequence
Transcript Sequence for observation asmbl_31641 of TGE0004810:
TGGTTTTAGGGCGGGGGACGAGCCCTCCGGGGCAGCTCCTGGGCCCTGTAGCCAACCTGCCCATCGCTCCCCTCCCACAACTTCTTTTTTTTTTCTCCAGACTTCGTCCTAATAAAAAAATTACGGAAGTAGAGCCTTGTTTTCCTGGAAGGCGCAGGTTGATTAGATGCTGTCGAGGGATCGGGGCCAACGGGCCTTTCAGTGTGTGAAGACTTCTTCCTTAGAGATCCTTTGACAGCAGTGCTGAGCATCCACATTTTGGTTGAATTCAGTGCGAAACTTGTTCTCGGTATGTAAACAGAATTCCTTATCCATTTGAAATAAACATTTCCAAGAAATGAAAGACTTCTTTCACTAGGATATTCTGGTCTGGTTCCATCTTCAGAGAATCTAGTTTTTGACTATGAAAAAGATGAGTTACTGGATCCTGAAGACCATCCCTGGATCTCGGGTTAAAAATCTGTTCTAATCTGAACCGTGGGAAGAAAGGGTCCTTGGTCGGCGGTATTCCCACCTGAAGGACATGATGTTTTCCAAACTAGCACATTTCCAGACCGTTGCCGTGCTGCGTCGAGGAGTTCACTCTTCAGTGGCTTCTGCTACATCCGTTGCGACTAAAAAAACAGTCCAAGGCCCTCTATCCTCTGATTACGTTTTTGAAAGGGAATCGAAATATGGCGCACACAACTACCATCCCTTACCTGTAGCCCTGGAGAGAGGAAAAGGTATCTACCTGTGGGATGTAGAAGGCAGAAAATATTTTGACTTCTTGAGTGCTTACAGTGCTGTCAACCAAGGGCATTGTCACCCAAAGATTGTGAATGCTCTGAAAAGTCAGGCAGACAAACTGACCTTGACATCTAGGGCATTCTATAATGATGTACTTGGTGAATATGAAGAGTATATTACTAAACTTTTCAACTATCACAAAGTTCTTCCTATGAATACAGGAGTGGAGGCTGGAGAGACTGCTTGCAAGCTTGCTCGTAGATGGGGATATACCGTTAAGGGTATTCCGAAATACAAAGCAAAGATCGTTTTTGCAGCTGGAAACTTTTGGGGTAGAACTATGTCTGCTATCTCCAGTTCCACAGACCCAAACAGTTACGAAGGTTTTGGACCATTTATGCCAGGTTTTGAAATCATTCCATATAATGATCTGCCCGCTCTTGAGCGTGTTCTCCAGGACCCGAACATCGCCGCATTCATGGTGGAGCCCGTTCAGGGCGAAGCGGGCGTCATTGTGCCAGACCCGGGCTACCTGACAGGCATCCGTGAGCTCTGCACCCGGCACCAGGTTCTGTTTATTGCTGATGAAATACAGACAGGATTGGCCAGAACTGGTAAATGGCTGGCCGTCGATCATGAAAATGTCAGACCTGATATAGTCCTTCTTGGAAAGGCGCTTTCTGGTGGCTTATACCCTGTGTCCGCAGTACTGTGTGATGATGAAATAATGCTGACCATCAAACCAGGGGAGCATGGGTCAACGTTTGGTGGCAACCCGCTGGGCTGCCGAGTGGCCATGGCAGCCCTCGAGGTTTTGGAAGAAGAAAACCTTGTTGAAAATGCAGATAAAATGGGTACCATCTTGAGAAACGAACTCATGAAGCTACCATCTGATATCGTAACTGCTGTAAGAGGGAAAGGATTATTAAACGCTATTGTTATTAGAGAAACCAAAGATTACGATGCTTGGAAGGTGTGTCTGCGACTTCGAGATAATGGACTTCTGGCCAAGCCAACCCACGGCGACATTATCAGGTTTGCACCTCCGCTTGTGATCAAGGAAGACGAGGTTCGGGAGTCCATGGAAATCATTAACAAGACCATCTTGTCTTTCTGAGGGTTGCGACTGTTTTCGGCGGTGCCTGTGAGTCAGCTGGAGACAGGCAGACAGTTCCTTGAAGTCCTGTAAAAAGCTTCTGCATTTTTGTGTGTGATGCAGGCACATTCCACTCCCTGTGTCTTCAAGGACTTATTTTTTAATATACATATTTTTCAGTTCATACATAATAGAGTGACATTTATAATCGTGCAGTATGCCATTTAACATAACTGTAAGAGAATGTAATGACATCTATATTCGATTGTTTTTGTGTACTTGTGTACTTTCTGAAGTGAAATGCATCTATTTGTCTGTCTGTAGGCAGCCTTACAATCAAGCCCCATATAACTTATATATGTTTTTATAATTTCTGGTGTAAATGTTTTATATTTGAAAAAGTTATATGGGGTTTTACATAAAAGACTTCTTTAACCTTATGAAGCTGAATTATAATCATTGAATTTTAGGAAGGTTAAGCTTATATAAAACACTAGATTTAAATAAACTTCATATTGGCCAACATCAGAATATATTCCATGAGTGTCATTATTTTGAATTAATAATTAATATTTAACATTCCCAAATTATTTT