Transcript asmbl_314

Sequence
Transcript Sequence for observation asmbl_314 of TGE0012341:
GGTGAGCCTCCGAGAGCCTCCTCCTCTTCGTGGACGAAGCGGACGCCTTCCTCAGGAAGCGAGCCACCGAGAAGATAAGCGAGGACCTCAGGGCCACCCTGAACGCGTTCCTGCACCGGACGGGCCAGCACAGCAGCAAGTTCATGCTGGTCCTGGCCAGCAACCAGCCCGAGCAGTTCGACTGGGCCATCAACGACCGCATAGACGAGATGGTCAGCTTCGACCTGCCACGGCTGGAGGAGCGGGAGCGCCTGGTGAGAATGTATTTCGACAAGTACGTTCTGAAACCAGCCACAGAAGGGAAGCAGCGCTTGAAGCTGGCTCAGTTTGACTACGGGACGAAGTGCTCGGAGGTCGCGCAGCTGACGGAGGGCATGTCGGGCCGGGAGATATCCCAGCTGGCCGTGGCGTGGCAGGCCATGGCCTATGCCTCCGAGGACGGTGTCCTCACCGAGGCCATGATGGACGCCCGAGTCCAGGACGCCATCCGGCAGCACCAGCAGAAGATGCAGTGGCTGAAGGCCGAGGGACCCGGGCCCGGCAGTGGCCAGCCCCTCCTCCTGAGTGCACGGACCAAGTGAGCTGGGCCTCGACAGCTGGGGACCCTGGGGCACACCCGCTTGGTGGCTTCGCCAGAGGAAACACCAAGGCGCCCGCGTCTCCTGGCGGCCAGCAGGGGGCTCTGCAGCCGCCCACCTCCCGGCAGTTTTTAATATTCCTCCGCTCAGGGCCAGGGCAGCATTAAAGGCCTCTACTTAGGACCAGCTGCGGCTGTGGCGTCTTTGTGGGGGGGAATCTGCCCCTCCAGGCTGTGGTTTTGGCTGGGGAGGGTCAGGCTGGGGCTACCCCCAGGACACTCCTAGGGGACGTGTCTCCAAGCCAGGCCCAGAGCGGGAAGAAGGCACAGCCCCCCGGTCCAGGGGTAGCTGAGAGCTGGCTGCTGCAGTGGGGGCGTCTAGCCAGGGGAAGGCCTGGCACAGTCGGGGATCCGTGAGGGGTGAGCAGAGCAGGCCCGTGCTGCCCGTCAGAGCTGCCCGCCTCTGCACTGGGGAAGAGGAGGTACCCTGTACACATCTGTGCCTGCCCTGGTGGGGGCCACACCGGGACTGGACACCTGACCTGACCAGGGTCGTCGGTGCTGGGGGCTGCCCAGGGGAGCCCCACTCTCCCTGGGTTGAGC