Transcript asmbl_3123

Sequence
Transcript Sequence for observation asmbl_3123 of TGE0004782:
CCCAGAGCCTCCGAGTTCCAACCGGTTCCTAATCTAGTTCCGCAGTCGTCCGCCTTTTCTTCCTTTTCAACATGACAGATGCCGCTGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTGGCTGCAGCCATCTCCAAGACGGCGGTAGCACCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAAATCACCGCAGATAAGCAGTACAAGGGCATTATAGACTGCGTGGTTCGTATCCCCAAGGAGCAGGGAGTACTATCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACCCAGGCTCTCAACTTTGCCTTCAAAGATAAATACAAGCAGATCTTCCTAGGTGGTGTGGACAAGAGAACCCAGTTCTGGCGCTACTTTGCAGGCAATCTGGCATCAGGTGGTGCCGCTGGGGCCACCTCCTTGTGTTTTGTGTATCCTCTTGATTTTGCCCGTACCCGTCTAGCTGCTGATGTGGGCAAAGCTGGAGCTGAAAGGGAATTCAAAGGCCTCGGTGACTGCCTGGTTAAGATCTACAAATCTGATGGGATTAGGGGCCTGTACCAAGGCTTTAATGTGTCCGTGCAGGGTATTATCATCTACCGAGCTGCCTACTTCGGTATCTATGACACTGCAAAGGGAATGCTTCCAGACCCCAAGAATACTCACATCTTCATCAGCTGGATGATTGCACAGTCCGTCACTGCGGTGGCTGGGTTAACTTCCTATCCATTTGACACTGTTCGTCGTCGCATGATGATGCAGTCAGGGCGCAAAGGAACTGATATCATGTACACGGGCACGCTCGACTGCTGGAGGAAGATTGCTCGTGATGAAGGAAGCAAAGCTTTTTTCAAGGGTGCATGGTCCAACGTTCTCAGAGGCATGGGTGGTGCTTTTGTGCTTCTCTTATATGATGAAATCAAGAAGTTCACATAAGTTATTTCCTAGTCTATTTTCCCCGTGAACAGGCATGTTGTGTTATGTAACATATCTTTGAGCATTCCTGACAGACTGTTGGCTATTTATCAGTGGCAACTATTTACTGGTTGAAAATGGGAAGCAATAATATTCATCCGACCAGTTTTCTCCTAAAGCTATTTCCATGATGATCATGATAATGATGGGACTCAATTATATTTTTTATTTCAGTCACTCCTAATAATAAATTTGAAGAAATAAAAAGTATCTGAAATACAA