Transcript asmbl_31113

Sequence
Transcript Sequence for observation asmbl_31113 of TGE0004781:
GGCGGGCCCGGCGTCCTCCCTCCTTGCAGATCCTGCGCCTGAAGAGACGCAGGCAGCTGACATTGTCTTCTTCGCGCGACTCTTTCTGCAGTCTGGAGAGTCCTCGGCCTCCTGTGCACAATGGCAACTCTTAAGGAAAAACTGATTGCACCAGTTGCAGAAGAGGCAGCGGTCCCAAACAATAAGATCACTGTAGTGGGTGTTGGACAAGTCGGTATGGCGTGTGCCATCAGCATTCTGGGAAAGTCTCTGGCAGATGAGCTTGCTCTTGTGGATGTTTTGGAAGATAAACTCAAAGGAGAAATGATGGATCTGCAGCATGGGAGCTTATTTCTTCAGACACCTAAAATTGTGGCAGATAAAGATTACTCTGTGACTGCCAATTCTAAGGTGGTGGTGGTAACTGCAGGAGTCCGCCAGCAAGAGGGAGAGAGTCGTCTCAATCTGGTACAGAGGAATGTTAATGTCTTCAAATTCATTATTCCGCAGATCATCAAGTACAGTCCTGACTGCATCATAATTGTGGTTTCTAACCCAGTGGATATTCTCACATATGTTACCTGGAAACTAAGTGGATTACCCAAGCACCGTGTGATTGGAAGTGGATGTAATCTGGATTCTGCTAGGTTTCGTTATCTTATGGCTGAAAAACTTGGCATTCATCCCAGCAGCTGCCATGGATGGATTTTGGGAGAACATGGCGACTCAAGTGTGGCTGTGTGGAGCGGAGTGAATGTGGCAGGTGTTTCTCTCCAGGAACTGAATCCAGAAATGGGAACGGACAATGATAGTGAAAATTGGAAGGAAGTGCATAAGATGGTGGTTGAAAGTGCTTATGAAGTCATCAAGCTAAAAGGATACACCAACTGGGCTATTGGATTAAGTGTGGCTGATCTTATTGAATCCATGTTGAAAAATCTATCCAGGATTCATCCAGTGTCAACTATGGTGAAGGGGATGTATGGCATTGAGAATGAAGTCTTCCTGAGCCTTCCATGTATCCTGAATGCTCGGGGATTGACCAGTGTTATCAACCAGAAACTGAAGGATGATGAGGTTGCCCAACTCAAGAAGAGTGCAGATACCCTGTGGGATATCCAGAAGGACCTCAAAGACCTGTGACTTCAGGCTTCTCGGCTGTAGAAATTTAAAAACTACAATGCAATTAACCATGAGCCTTTAGTTTCCAATTATGTACATGGATCACAGTTTGCTTTTATCTCCCTAAGTATGTGAATCTGGGCTCACAGAATCAAAGCCCATGCTTGATTTAATGCTTGCAATATGAGTCCTTGAACAAATAAAATTAACTATCATAGTGTGCTTCTGCTTATGGAATTCTTCCTTTAATGGTTTCTGAAAGATTTCAGTCAGTTTTTCAAATA