Transcript asmbl_31098

Sequence
Transcript Sequence for observation asmbl_31098 of TGE0004778:
TCTTGCTAACTTCCTTCCTGTTCTAACTGCCAGTACTCAGAAGTCAGAGTTAAGAGACAGAGGCACCCCGGACAGAGACGTGAACAACTGAATATCAAAATGACTGAAAAAGCCCCAGAACCACACCTGGAAGAGGATGATGATGAACTGGACGGCAAGCTCAATTACAAGCCTCCACCTCAGAAGTCCCTGAAAGAGCTGCAAGAGATGGACAAAGATGATGAAAGTCTAGCTAAGTACAAGAAAACACTCCTGGGAGATGGTCCTGTGGTAGCAGACCCAACAGCCCCCAATGTCACTGTCACCCGCCTTACCCTGGTATGTGAGAGTGCCCCAGGACCAATCACCATGGACCTCACTGGGGATCTTGAAGCCCTCAAAAAAGAAATTTTTGTGCTAAAAGAAGGTGTTGAATATAGAGTCAAAATTCACTTCAAAGTGAACAGAGATATTGTGTCAGGCCTAAAGTATGTTCAGCACACCTACCGGACTGGGGTGAAAGTGGATAAAGCCACATTTATGGTTGGCAGCTATGGGCCTCGACCAGAGGAGTATGAATTCTTGACTCCAATTGAGGAGGCTCCCAAGGGCATGCTGGCCCGAGGCACCTACCACAACAAGTCCTTCTTCACCGACGATGACAAGCACGACCACCTCACCTGGGAGTGGAATCTGTCCATTAAGAAGGAGTGGACAGAATGAGCACGTCTGCCCCTTACTGTCCCTACCCTTGGCACTTGGAAGAACCCTCTCAGTCATGTTCACTGCACTGTCCCTTCTCCCTGATCACAGCTGGACCCCTTTCCCAACACCCCCACATCGTCTCTCTGATGCATCTTCTCCCACACTCTCTCAAAGTGGTCCCTGGTACTGGATGCTTAAAACCCAAGCTTCAATCCTGCCCACTCCTTCTGACTCCCATCACGGCCAGACCTTCGAAGTTCTCCACCTCAATACACGATCATTTAATATCTCTTATTCCCATTTGAACAGCTAGAGGCCAGGAAATGGGCGAATGATCACTAATTGTTCTTTTGCCTTCGGTTCCAAGGCTCATTCTCACCCCTGGATTCTTCTGTGGTTGCTGCTGGCTCTATGAAGGTCCCTAGTCACATTCCCTGCCAGATGGGTTCTTCTTTTCTGGGAGACACTGTAAACAGCACAAGAGAGTAAGAATAAAACAATCGTATGATCTGACTGAGA