Transcript asmbl_31092

Sequence
Transcript Sequence for observation asmbl_31092 of TGE0004776:
AGGGTGCCTCGTCCAGGCTGCTACAGAGGAGTGGCGGGCCCTGGAGACAGGCTAGCGGTGTCGGCGTGAACTAATTCGTTCAAGCCTTGGGCTGCAGAACTGCCCAGAAGAGTGCCGAGAAGGTGGCGCGTAACTTCGGCAGATCCCAGAAGTGCAGCTAGGAAACTTGCCCAGCCAGCCAGGCCCATAGGGTGCTAGAGGGTCAGGAAGGACCCGCCTTTCCTAGACCGTGGCCCAACAGATCCACGTGAGGCTTCCTCGCCACCAAAAGCCCCAAACAAGCAGGGCTAATGAAAGAGGAAAGTTAAGGACGTCCCAAGCTCTGAGACGCGGCGCCCCGCTGCCGGCGCAAGAGCTGCTCTTCCAACAGCTGCGCTTGCAGTCGCCTTGTCCAGCCGAGCGGAGGTCGCTGCCGCTGAGTGATGTCCCGCCGCAGCCTGGACGGGCGCCTCCTCGGGCTGCCCGCGACGTCGGCCCCGCCGCTGCCCCCCAAGTTGCTGCTGTTGCTGCTGCTGTCGGCCGCCGCGGTGCCACCGAGCCTGGCAGAAGTCTTCTATGCAACTGCGTACTGGATGCCTGCTGAAAAGACAGTAAATGTCAAAAATTTACTGGACAAGAATGGGGATGCCTATGGCTTTTATAATAACTCTATGAACACCACAGGCTGGGGGATCCTTGAGATCAAAGCAGGGTATGGTTCTCAGACCCTGAGCAATGACATCATCATGTTTGTGGCTGGATATTTGGAAGGTTACCTCACTGCCCCACACATGTATGACCACTTCATAAATCTCTACCCACAGCTGATTAAGAAACCTTCCATCGTGGATAAAGTGCAGGAGTTTATGAAGAAGCAAGAAGAATGGGCACGTAATAACATCAAATATTATAAGGATGACCCATTTTGGAGACATACTGGCTATGTTATGGCACAAATGGATGGGCTGTATGTAGGAGCGATGAACAGGGCTACATTAATAGGGACAAAGCCTATGACACTGTTCCAGATTCAGTTCCTGAATGCTGTTGGAGATCTGTTGGATCTGATTCCCTCACTTTCTCCCCCAAAAAACTCCAGCCTGAAGGTTTTTAAGAGATGGGACATGGGACACTGCTCTGCTCTTATTAAGGTTCTTCCTGGGTTTGAGAACATCTATTTTGCTCACTCAAGCTGGTACACGTATGCAGCCATGCTCAGGATATATAAACACTGGGACTTCAACATCGTCGATAAAGATACCAGCTGTAGTCGCCTCTCTTTCAGCAGTTACCCAGGATTCTTAGAGTCTCTGGATGACTTTTACATTCTTAGCAGTGGTTTGATATTGCTGCAGACCACAAACAGCGTGTATAATAAAACCCTACTAAAGTTTGTGACACCCCAGTCTCTCCTGGCCTGGCAAAGGGTCCGCGTGGCCAATATGATGGCCAATGGTGGCAGGCAGTGGGCAGAGATCTTTTCAAAATACAATTCTGGCACCTATAACAATCAGTACATGGTCCTGGACCTGAAGAGGGTAAAGCCAAAATATAGCCTTGACACAGAGACTCTGTACATTGTGGAGCAAATTCCTTCATATATAGAATTTTCTGACCAAACCGATGTCCTACGGAAAGGATACTGGCCCTCTTACAACATTCCTTTCCATGAAAAAATCTACAACTGGAGTGGCTATCCAATGTTAGTTCAGAGGCTGGGTTTGGACTACTCATATGATCTGGCTCCACGAGCCAAAATCTTCCGGCGTGACCAAGGGAAAGTGACTGATATGGCATCCATGAAATATATCATGCGATACAACAATTATAAGAACGATCCTTACAGTAGGGGTGATCCGTGCAATACCATCTGCTGCCGTGAGGACCTTAACTCACTTAACCCAAGTCCTGGAGGTTGCTATGATACAAAGGTGGCAGATATTTACCTAGCATCACAGTACACAGCACATGCCATTAGTGGTCCCACAGTACAAGGTGCCCTCCCTGTTTTTCACTGGAACCAGTTCAACAAAACTCTCCATGAGGGCATGCCAGAAGCCTACAACTTTGATTTTGTGACCATGCAACCAATTTTGAAACCTGACAAAAAATGAAGGGGGAATATGAGGGAATAGAAGGCTGCAAATAAGATACCAAAGGCACTATTTTAACTGTTTTTCCATTCAAGATTAGTCTTAATAAAATGTCTTAAATTTA