Transcript asmbl_30819

Sequence
Transcript Sequence for observation asmbl_30819 of TGE0012318:
TTTTTTAAAGACGGCAGCTGAAGGATAGGATCTCTAAATTTAGAGGATCGGAAAATAGAAGACCTTCGACAGTGCCTGAACAGGTACAAGAAAATGCAAGATACAGTGGTACTGCCCCAAGGTAAAAAAGGCCAAGATGGTGACTATGAAGATCTGCTCACTTCTGGTTCTATCTCCACTCTGCTGGACACGCAGGGTTTTAGCGATCTGGAGAAAAGTCTGTCGTCTACACCAGTAACGGGATCTCCCAGTCGTGACCCATTTAACACAAGTATTCCAGAAGAGTTCCACACCAGCATCTTGCAAGTTTCAATCCCTTCATCTAAAGGCTTGGAAACTTCTGAAAAAGGAAAATTGCCTCCTAAGCCAGAGACTTCGTTTGAAGAAAATGATGGAAAAATGATCCTTGGTGCTGCTTCTGAAACCCAACTGTGTGACAGTCTTTCAACTTCAAGTCTGCAGAAGTCTAGCAGCTTGGGCAATCTGAAGAAAGAGTCATTGGATGGGGAAAAGGAGTCTGTTCAGAAGCCTTCAGAGGACAAAGCTCCAGAAGCAAGCAGCCCGTTTCAGGGCCTCCCTCCCAAAGCTCCAGGACACAATGCCTCCGTGGACGACAACCCCTTTGGTACTCGTAAAGGCAGATCTTCCTTTGGTCGTGGCTTTTTTAAAATAAAAAGTAACAAGAGGACAGCAAGTGCACCAAACTTGGATCGTAAACGAAGTGCCAGTGCACCCACCTTAGCTGAAACAGAAAAGGAGACAGCCGAACACCTAGATCTGGCCGGTGTATCTTCTCGGCCAAAAGATTCACAAGGGGGCAGTCCCTTCCAGATATCTCCACCATCTCCAGATTCCAAAAAGAAGTCCAGAGGCATCATGAAACTCTTTGGAAAACTTAGGAGAAGTCAGTCGACTACCTTCAACCCAGACGACATATCTGAAACTGAATTCAAAAGAGGAGGGACAAGGGCAACTGCTGGTCCCCGATTGGGTTGGTCTCGAGATTTGGGACAATCTAATAGTGACTTAGATATGCCATTTGCCAAATGGACCAAGGAGCAGGTTTGCAGTTGGCTTATGGAACAAGGCTTGGGGTCCTACCTGAATTCTGGCAAGCACTGGATTGCATCTGGCCAAACACTTTTGCAGGCTTCTCAACAAGATCTAGAGAAGGAACTTGGAATCAAGCATTCTCTTCACCGAAAGAAACTCCAGCTGGCACTGCAAGCTCTGGGATCTGAAGAAGAAACCAATCATGGAAAGCTGGATTTCAACTGGGTCACTAGATGGTTG