Transcript asmbl_3013

Sequence
Transcript Sequence for observation asmbl_3013 of TGE0012279:
CAGCCGGCGCCCTTCTCCCGAGCGTGGTCTGGGGCGGGCAAAACGCCCTCCGGATTAGTGTCGCGCAGGGTGGCGGCTGCACACACAGGCGGTGCAAGACCGCCCGCGCTAGGACCCGCCGGCCCGGAAACGCTTGCTGTCACAAAGGGGGCAACACGTGGGGGCGACGCGTGGGCGCAGACGGCCAGGGCAGCCCGGAGAACCGCCCACTGTCTCGGCCACCTGACTCCTCGGTCCCAGCCGCCAGGTCGGTCCAGCTTCGGCCGGCGCCCGGCTGTGAGGTGGACGCCCGAACTCCGTCTGATCACCTCCCTCCAGTCTTTTCCACCTGGTTCGGACGCCTGCATAATCATGTCCATCCTCTACGTCTCCCCTCACCCCGATGCCTTCCCCAGCCTCCGAGCCCTCATAGCTGCGCGCTACGGGGAGGCTGGGGAGGGGCCGGGGTGGGGAGGGGCCCACCCCCGCATCTGTCTCCAGCCGCCTCCGACGAGCAGGACTCCCTTTCCCCCACCACGTCTGCCCGCCCTGGAGCAGGGGCCCGGTGGGCTCTGGGTGTGGGGGGCTACAGCTGTGGCCCAGCTGCTGTGGCCAGCAGGTCTGGGGGGCCCTGGGGGCAGCCGGGCAGCTGTCCTCGTCCAACAGTGGGTTAGTTACGCAGACACGGAGCTAATACCAGCTGCCTGTGGGGCAACGCTGCCCGCCTTGGGACTCCGCAGCTCTGTCCAGGACCCCCAGGCTGCACTGGGGGCCCTGGGAAGAGCTCTGAGCCCCTTGGAAGAGTGGCTTCGGCTACACACCTACCTGGCTGGGGAGGCCCCCACTCTGGCTGACCTGGCGGCTGTCACAGCTTTGCTGCTGCCTTTCCGATATGTCCTGGACCCCTCTGCCCGCCGGATCTGGGGTAATGTCACTCGCTGGTTTATCACATGTGTCCAGCAGCCAGAATTCCGGGCTGTACTGGGAGAGGTGGTTCTGTACTCAGGGGCCAGGCATCTTTCCCAACAGCCAGGCCCTGAGGTCACTGCACCCCCAAAGACAGCCGGCCAACTCAAGAAAGAAGCAAAGAAACGGGAGAAGCTACAGAAATTTCAACAGAAGCAGAAGATCCAACAGCAGCAGCCACCCCTAGGGGAGAAGAAACCAAAATCAGAGAAGAGGGAGAAACGGGATCCTGGAGTCATTACCTATGACCTTCCAACCCCACCTGGGGAAAAGAAAGATGTCAGTGGCACCATGCCTGACTCCTATAGCCCTCAGTATGTGGAGGCGGCCTGGTACCCTTGGTGGGAGCAGCAGGGTTTCTTCAAGCCAGAGTATGGACGTTCCAGCGTGTCAGCACCAAATCCCCGGGGCATCTTCATGATGTGCATCCCACCCCCCAATGTGACAGGCTCCCTGCACCTGGGCCATGCGCTCACCAACGCCATCCAGGACTCCCTGACCCGATGGCACCGCATGCGTGGCGAGACGACCCTGTGGAACCCTGGCTGTGACCATGCGGGCATTGCCACCCAGGTGGTGGTGGAGAAGAAGCTGTGGCGAGAGCAGGGCCGAAATCGGCATGATTTGGGCCGTGAGGCCTTTCTACGGGAGGTCTGGAAGTGGAAGGAGGAAAAAGGTGACCGGATTTACCACCAGTTGAAGAAGCTCGGCAGTTCCTTGGACTGGGATAGAGCCTGTTTCACCATGGACCCTAAATTGTCAGCAGCTGTGATAGAGGCCTTCGTCCAGCTTCATGAGGAAGGAGTCATCTACCGCAGTACCCGCCTTGTCAACTGGTCCTGCACTCTCAACTCTGCCATCTCCGATATTGAGGTGGATAAGAAGGAGCTGACAGGTCGCACCCTGCTCTCTGTGCCTGGCTACAAGGAGAAGGTGGAGTTTGGGGTCCTCGTTTCTTTTGCCTACAAGGTCCAAGGCTCAGAGAGCAATGAGGAGGTGGTGGTGGCAACAACACGGATTGAGACAATGCTGGGAGATGTGGCCGTAGCTGTACACCCCAAAGATCCCAGATACCAGCACCTGAAGGGGAAGATCTTGATCCACCCATTCCTGTCTCGGAGCCTCCCCATCATCTTTGATGATTTTGTGGACATGGAGTTTGGCACAGGTGCGGTGAAGATCACCCCTGCACATGACCAGAATGACTATGAGGTTGGGCAGAGGCATGGGCTGGAGGCCATCAGCATCATGGACTCCCGAGGGGCCCTCATCAATGTGCCCTTGCCTTTCCTGGGCCTACCCAGGTTTGAGGCCAGGAAGGCAGTGTTGGCGGCACTGAAGGAGCAGGGACTGTTCCGTGGTATTGAGGACAACCCCATGGTGGTGCCACTTTGCAACCGGTCCAAGGATGTGGTAGAGCCTCTACTGCGGCCACAGTGGTATGTGCGCTGTGGGGAGATGGCCCAGGCCGCCAGTGCTGCTGTGACTCGGGGCGACCTTCGAATCCTGCCTGAGACCCATCAGCGGACTTGGCATGCCTGGATGGACAACATCCGGGACTGGTGCATCTCCCGGCAGCTGTGGTGGGGCCATCGCATCCCAGCCTACTTTATCACTGTCAACGACCCAACCATACCCCCAGGGGAGGACCCTGATGGGCGGTACTGGGTGAGTGGGCGCAGCGAGGCCGAGGCCCGTGAGAAGGCAGCCAAGGAATTTGGAGTGTCCCCTGACAAGATCATTCTCCAGCAAGATGAAGATGTATTGGATACCTGGTTCTCCTCTGGCCTCTTCCCCTTCTCCATCCTGGGCTGGCCCAACCAGTCAGAAGACCTGAGTGTGTTCTACCCGGGGACGCTGCTGGAGACGGGCCATGACATCCTCTTCTTTTGGGTGGCCAGGATGGTCATGCTTGGCCTGAAGCTCACTGGCAGGCTGCCCTTCAGAGAGGTCTACCTTCATGCCATCGTGCGAGATGCGCATGGCCGGAAAATGAGCAAGTCTCTGGGCAATGTCATTGACCCTCTGGATGTTATCCACGGAGTCTCCCTGCAGGGCCTCCACGACCAGTTACTGAACAGTAACCTGGATCCCAGCGAGGTGGAGAAGGCTAAAGAAGGGCAGAAGGCGGACTTCCCGGCAGGGATTCCCGAGTGTGGCACTGATGCCCTCCGGTTTGGACTGTGCGCCTACACGTCCCAGGGTCGTGACATCAACCTGGATGTGAACCGGATACTGGGATACCGCCACTTCTGCAACAAGCTTTGGAATGCCACCAAGTTTGCCCTCCGTGGTCTGGGGAAGGGTTTTGTGCCCTCAGCCACCTCCGAGCCTGGAGGCCATGAGAGCCTGGTAGACCGCTGGATCCGCAGTCGGCTGACTGAGGCCGTGAGGCTCAGCAACCAAGGTTTCCAGGCCTACGACTTCCCAGCTATCACCACCGCCCAGTACAGCTTCTGGCTGTATGAACTCTGTGATGTCTACCTGGAGTGCCTGAAGCCCGTGCTGAATGGGGTGGACCAGGCAGCCACAGAGTGCGCCTGCCAAACCCTCTATACCTGTCTGGATGTTGGCCTGCGGCTGCTCTCACCTTTCATGCCATTTGTGACCGAGGAGCTATTCCAGAGGCTGCCCCGGCGGATGCCACAAGCACCCCCTAGCCTCTGTGTCACCCCCTACCCAGAGCCTTCGGAGTGCTCCTGGAAGGACACTGAGGCAGAAGCTGCCATTGAGCTGGCCCTGAGCATCACGCGAGCCGTGCGTTCCCTGCGTGCTGACTACAACCTCATCCGGATCCGACCCGACTGTTTCCTGGAAGTGGCTGACGAGGCCACAGGTGCCCTGGCATCAGCAGTGTCAGGCTACGTGCAGGTGCTGGCCAGCGCAGGTGTGGTAGCTGTCCTGGCCCTGGGGGCTCCCGCACCCCAGGGCTGTGCTATGGCCCTGGCCTCTGACCGCTGCTCCGTCCACCTGCAGCTGCAGGGGCTGGTGGACCCGGCCCGGGAGCTAGGCAAGCTGCAGGCCAAACGTGGTGAGGCGCAGCGGCAGGCCCAGCGTCTGCGGGAACGCCGCTCCACCATGAGCTACCCAGTCAAGGTGCCCCTCAAAGTCCAGGAGGCAGATGAAGCCAAGCTCCGACAAACAGAAGCAGAGCTCAGGAAGATGGACGAGGCTATCACCCTTTTTCAGAAGATGGTGTGATACACCAGCTCCAACCCACAGTGGTCTACCATGGGACTGGCAGCAATAAATATTTTGCCACAAAA