Transcript asmbl_29951

Sequence
Transcript Sequence for observation asmbl_29951 of TGE0000916:
GGGTGGCATTGTGTGTCCCGGAGTGCAGGAGCGAGTCCCAGAAGAGAGGCGAGGCTGAGCCCAGAGCGCTGGGCTGCTTCAGCAGGGAAGACTCCCTTCCCCCTGCTTCAGGCTGCCGAGCACTGAGCAGCGCTCAGAATGGAAGCCATCGCCAAGTATGACTTCAAAGCCACTGCAGACGACGAGCTGAGCTTCAAAAGAGGGGACATCCTCAAGGTTTTGAATGAAGAATGTGATCAGAACTGGTACAAGGCAGAACTCAATGGGAAAGATGGCTTCATTCCCAAGAATTACATAGAAATGAAACCACATCCGTGGTTTTTTGGCAAAATCCCCAGAGCCAAAGCAGAAGAAATGCTTAGCAAACAGCGGCATGATGGAGCCTTCCTTATCCGAGAGAGCGAGAGTGCTCCTGGGGATTTCTCCCTCTCAGTCAAGTTTGGAAACGACGTGCAGCACTTCAAGGTGCTCCGGGACGGAGCCGGGAAGTATTTCCTCTGGGTGGTGAAGTTCAATTCTTTGAATGAGCTGGTAGATTATCACAGATCTACATCCGTCTCCAGAAACCAGCAGATATTCCTCCGGGACATAGAGCAGGTGCCACAGCAGCCGACATACGTCCAAGCCCTCTTTGACTTCGACCCCCAGGAGGATGGAGAGCTGGGGTTCCGCCGGGGAGACTTTATCCACGTCATGGATAACTCAGACCCCAACTGGTGGAAGGGGGCGTGCCACGGGCAGACCGGCATGTTCCCCCGCAATTACGTCACCCCTGTGAACCGGAACGTGTAGGAGTCGAGGGGAGAGTATTTAAAGAAAGCGAAACATGGAAAACACGTCCAAAAGAATTCACCCCACGAGCTGCTCTAGCGGCAGCCTGCGAGGGGCTCGGAACACCTTGCCGGGTCACCCGATGACCCTCTCACCTGGTTGGAACTTTGGGGGGTGGGAGGGGGAGTTGGATATAACAATGCCAAAACTTACCTATAAATTAAGAAAAAGAGTTTTTATTACAAATTTTCACCGCTGCTCCTGTTTCTCTTCCTTTGTCCTTTTTTTCATCTCTTTTCCCTTCTGTCCATCAGTGCATGACGTTTAATGCCACATATAGTCCTAGCTGATGCCAATAATAAAAGAAAAGAAACCAAGTGGGCTGGTATTTTCTCTATGCAAAACGTCTGTTTTAGTCAGAATGACTGAAGGAACAGCCGTTGCTGGGCGCTTCATGTACACACGCAGAAGCGGCGGCTTCTGCCCAAGGAGGGGCGGGCGAGTAGGAATCCGCCTTCCAGCCCCCACCCCAGTGTCTCCGTCAAAGTTGGAAACAGAGAGGGGGTGAAAGGAGGCAGCGTTGCCCCTTATGACTTCCTGAGAAAGTCAAGCTGAAACCCGTGTCTCTCTCTCTCCGCGTTTTTCCCTTCCGAATGGTATTACTGAGCATGTCGTTTTTTATAGTGCCTTTTTCCTTATTTCAAGGGTTGCTTATGAGTGGTGTTCTTTTTGTTTTGTTTTAAAATAAGTTAAAGACAGTCTAGAGCTTTTCAGCTGGTGTGTCTCCTACTCTGTGTAAATATTGTTCCCTCAGGGGGAGGGGAGAACAGGGTAGAGAAGAGGAGGCAGGTAGAAGTGCGGGCTGCGGGCATTCTGCGTCCTAA