Transcript asmbl_29798

Sequence
Transcript Sequence for observation asmbl_29798 of TGE0004667:
ATCATTCGTGTTCAGTCCCCGGATGGGGTGAAGCGGATCACGGCAACAAAGAGAGAGACAGCTGCGACGTTCCTGAAGAAGGTCGCAAAGGAGTTTGGCTTCCAGAATAATGGCTTCTCAGTTTACATCAATAGAAACAAGACCGGAGAGATAACAGCATCGTCCAACAAATCCCTCAACCTGCTAAAGATCAAGCATGGCGACTTGTTGTTCCTATTTCCCTCGAGCCTTGCCGGACCGTCATCTGAGATGGAGACGTCCACCCCGCCGGGCTTGAAGGCCCTGGGCGCGCCCACCGTGGTGGAAGATGAGATCGACCAGTACCTCAGCAGGCAGGACGGCAAGATCTACAGGAGCCGCGACCCGCAGCTATGCCGACACGGCCCTTTGGGGAAGTGCGTGCACTGCGTCCCTCTAGAGCCATTCGATGAGGACTACCTAAACCATCTCGAACCGCCCGTGAAGCACATGTCCTTCCACGCCTACATCCGAAAGCTGACCGGAGGGGCTGACAAGGGGAAGTTTGTCGCCCTTGAGAACATCAGTTGCAAGATTAAATCAGGGTGCGAGGGACACCTTCCGTGGCCTAATGGCATCTGTACTAAGTGCCAGCCGAGTGCCATCACGCTGAACAGACAGAAGTACCGACACGTGGACAACATCATGTTTGAGAACCACACGGTCGCTGACCGCTTCCTCGACTTCTGGCGGAGGACGGGGAGCCAGCATCTCGGGTACTTGTACGGGCGCTACACGGAGCACAAGGACATCCCTCTCGGCGTCAGGGCCGAGGTGGCGGCCATTTATGAGCCTCCTCAGATTGGTACACAGAACAGCTTGGAGCTCCTTGAAGACCCAAAAGCCGAGGTGGTGGATGAGATCGCTGCCAAACTTGGCCTGAGGAAGGTTGGCTGGATATTTACGGACCTTGTCTCAGAGGACACCCGAAAGGGCACAGTCCGATACAGCCGGAATAAGGACACCTATTTCTTGAGTGCAGAAGAATGTATCACTGCAGGAGACTTCCAAAATAAGCACCCCAACATATGTCGGCTCTCTCCAGACGGACACTTTGGATCCAAGTTCGTTACTGCTGTGGCTACAGGTGGCCCCGACAACCAGGTCCACTTTGAAGGGTACCAGGTGTCCAATCAGTGCATGGCGCTGGTCCGTGACGAGTGCCTGCTGCCGTGCAAGGACGCCCCTGAGCTCGGCTACGTCAAGGAGTCCAGCAGTGAGCAGTACGTGCCCGATGTGTTTTATAAGGACCTAGACAAGTTCGGCAACGAGATCACCCAGCTGGCCCGGCCCCTGCCCGTGGAGTACCTGATCATAGATATCACAACAACTTTCCCCAAGGATCCAGTTTATACTTTTTCTATTTCGCAAAATCCGTTTCCTATTGAAAACCGGGATGTGCTGGGTGAGACACAGGACTTCCACAGTTTGGCCACCTACTTGTCCCAGAGTACCTCAGCTGTATTTTTGGATACCATCTCGGATTTCCACCTCCTGCTGTTTCTGGTCACCAATGAAGTCATGCCTCTGCAGGACAGCATCAGCTTGCTGCTGGAGGCCGTGAGGACCAGGAACGAGGAGCTGGCGCAGACCTGGAAGAAGTCTGAGCAGTGGGCCACCATTGAGCAGCTCTGCAGCACAGTCGGAGTGCAGCTTCCGGGCCTCCAGGAGTACGGTGCCGTTGGGGGCCCCTCGCACGCCGCCGCGGCCGCCATGTGGGCCTGTCAGCACTGCACCTTCATGAACCAGCCGGGCACTGGCCACTGTGAGATGTGCAGCCTCCCCAGGACCTAGGGCTTCTGCCCCTGTGGCGGGGCCGGGCCCCTAGCCCTCCCTGAAGCCAGGACCTTTGTGACCGTGCCCCTTGGGCAGCCCTGAGGGGCGAGGCAAGGTAGCTGCCCCCCGGGTTCCTGATCCACAAGGCTTCTCAGCATCAGGCTTCCCTGGAGGAGGGCCCGGCTGGTGCTCTGCCAGCTGCTGGCAGCCACCTCGGGCAGGCGCAGCCCAGACACCTCTGGTGTCAGCCCCACCGTGGTGGAGGGACTGGCACCCCATCTTCACCCGGAGCGGAGGGGCGGGGCGCTCGCTGCTGCCTTGGCCTCCTTTCTCCTTCTGGATGCTTTCTGTTCTTGCCTCCCCCTGGTTTGGTGGGGGTCCCCCTTGGCCTCTCCATCCTGCTGCTCTGGGGCAGACCCTACCCTGAGGCCACTTCCTCCCTTCCCGGAGCCATCATCCGGTGGAAGTGCGAGTGGCCTCCGGCTCGCTGGCCTCCCTCTGCTTGATCTGCAGGTTGATTTGCTGCCCACCCTCTCTCCTGCTCCCGCCTGCCGTTCAGGTGGGATTTTAAAGTCGGCATTGGTTGTAATAACAGTTATTAGTAATTTCTGCCCAGAAGACTTTTATTTATTTTTTTTAAGATAAAAAATGCATAAAAGGGGAGTGAGAGAGACTAGTTTCCTCTTCCTTCTCTCCTCTAGTGAGTCCCCGTGGGTGTGTGCAGGGCGGGTGAGTGTGGCAGGGGACTCACAGTCAGTTCTCCATGGAAGCTAACCTCAGTGCCTGAGACTTTTCTGCCAAGCCACACAGCTGCAGGTACGGGCCGACCCAGCAGGAGTGGCGCGGTGGCTCCACCAGGCAGGTGGCTCCACCAGGCAGATGGCCCCTGCAGACGGCTGATGCCCCTGACCAGGCCCACATGGGGTGAGCCGAGTTAGCCAAGGTCAGAGCTCGGGTTCCCTTTGCCCCACACAGTCCCATAGCCCTGCCTGGCCCCTGGTCTCTGGCACAGTGACGTGGCCATCAAGAAAAGGAGCAGGGGCTTGACCTGTCGTGAGCGCACATGGGTCGGCTGTGGGGGCATCGGCAAGTTGCTGCTGTGCTGATGGAGTGAGGTCCGCACCCTCCCAGGACAGAGATCTGGGCAGACCTCGCACATGTGCCCTGTGGTCCCGCATTCTCTCCACGGCTGGGGTGTGTTCAGGCCCTTCCCCAGGGACTCGTGGGCATGCTGATGCCTCTTTGCCTTAACAAGAGCCGTATCTCTGAGCTGCCCCGCACCCATGGGAGAGGCCAACCAAACAGACTGCTTGGGGACTTCGGGTCTGCCCTGGGTTGGGGGCCAGCCTGTGGGACCCTCCCTTTCCCTCGGGGCTGTGCACAGAGCACTGAGTGTTGGCTTCTGCCCTAGTAAGGGCCACATCAGGCACCTCCGGGTCCACCCACCCAGACTCGTCTGCTCTTGGGGCCAGGGGCCAACTCGGCTGGGTCTGGCGGTGGCAGAGCAGCTGACCTGGAGGGGCCGGAAGGGCAGAGCAGCCCGGCAGAAGCGCAGCAGCCTGGCGAGGACTGGCTGGGGGCACTCTCAGCAGGTGCCCTGGCTGGAGCTCCTGCCTCATCTTCTGGTCCCTGCAATCAGATGCGAGGCCGCGCTGGGCCCTGCGTTCGGCCTGTCCCCCGGCGCCGGGGGAGGCCGGAGGTACCGGCTTCGAGAGCACCGGCCCCCCTCCCGCCTGCTCTGTCATCACCAAGCTAGTTTCGTTTTCAACCAATACTTCACTCGGAAGCTCTGGCATCGCATCATTCATTTGTTTCCTTCTGTCTTTTAGCTAAAGAAAAAGCTTTGTTGTGATTTC