Transcript asmbl_29790

Sequence
Transcript Sequence for observation asmbl_29790 of TGE0004664:
GGCTGGGGCAGGCCTCCTTTGTGGCCGCGCCAGTGGCCCTCGGGCCCACCTTCCCAGCCGGTGCGCGCGGGAAGGGACCAGGCCTGACGCCCTTACCCCGAAGAAGGCGCGCCCGTCTTCTGGACATCCCCGAGCTCCCCACCCCACTTAACCCCACCCCGCGCCTGGCCCAGATTGCGGGGCCCAGCGAAAGTACGGGCGGCGGCATCGCTCTCGGAGGATCCTGTCGCCTGCGGCCGCACTGGGTGGCGTTAGGGCGTGAGCCTTCTACAGGAATTCCAGAGGAAGCGGCTGGGAGGCCTGGAAGAGCCGGCGGCCCCACCCTGCCTGCGGCGGCCGGCCCGCTCTAGGTGTGGCAGATCCAGCTAGAGGCAGCATGGCCGAGCAGGAGCCCACCGCCGAGCAGTTGGCGCAGATTGCGGCGGACAACGAGGAGGACGAGCACTCGGTGGGCTACCGGCCCCCGGCCCAGAAGAGCATCCAGGAGATCCAGGAGCTGGACAAGGACGACGAGAGTCTGCGCAAGTACAAAGAGGCCCTGCTGGGCCGTGTGGCTGTGGCCGCTGACCCCAATGTCCCCAACGTTGTTGTGACCCGCCTGACCCTGGTGTGCAGCACAGCCCCGGGCCCCCTGGAGCTGGACCTGTCTGGGGACCTGGAGAGCTTCAAGAAGCAGTCGTTTGTGCTGAAAGAGGGTGTGGAGTATCGGATAAAGATCTCTTTCCGGGTGAACCGAGAGATCGTGTCCGGCATGAAGTACATCCAGCACACGTTCCGGAAAGGCGTCAGGATCGACAAGACCGACTACATGGTGGGGAGCTACGGGCCGCGCGCCGAGGAGTACGAGTTCCTGACGCCCGTGGAGGAGGCGCCGAAGGGCATGCTGGCCCGCGGGAGCTACAACATCAAGTCCCGCTTCACAGACGACGACAAGACTGATCACCTGTCCTGGGAGTGGAATCTCACCATCAAGAAGGAGTGGAAGGACTGAGCGTAGGCCTGGAGGCAGGCAGGGTGATGGCGGGGCGCACCCCCCACCCCTCCCCCACCCCCATACCAAAGTGCTGACAGGGCGCCTGCCCACGCTGCGGTCTTTCCCCCTGGTCCGCCTCCCGGCCAGCCCGGCCCCCCTCGACCCTCCCCAGCCTGCAGCCCCCAGCCTCCTGGGTGGTCTCGTGTCACTGCTGCTTCATTCTGTGCTGTGAGGGGAGGACGGCCGTAGCCCAGGCCTCCCCCTCCCCCTCTGTGTCCCTCCACGTTCCCCCACCTGTCCTGACCCCGCCTGAGGCCCTGGCTTTTCCGAGGCAGTGGGGCATTGGATGGGGTCTCGTGGTTTCAGTTGCCCCAACTCCCATCGTCTCCCCCTGCGGGGTGGGGGTGGGGTGCATGATGCAGGGCCTTGTGGGGACCAGCCGTCCCCCAGCTGTCACTCTTCCCTGGTCAGCTTGCCCACCGTTGTCAGTAACCATCTAACCATGATGCCTTAACATGCAGAACGTGTGCGTGGGGCCGTCACTAATCTCTGACCCCTGTGTCTGCATGAGCATGTGGTCTCCCCCAGTCCCTTTCCCAGCTGCAGTCCCGGTCGCCCAGGGAGGTGTAGGATGTGCTGCTGCTGTTCCCCGGCCTGCCAGGGCCTGGCCAGCCCCCTCCCCGTGGCCCTCCCCTAGCCCGGGCTGTGGGGACAGTCCCAGGCGCTTAGGGAAAGCCAAATTGCCAAAACTCAAGTCGCCTCCAGTCTCATCGGGGAGGCTGGGTGTCCTCATGCCTCTGCCTTCTTTGTCCCAGTGGGCAGCACCCAGACCCAGACCCCACAGCCCCGACAGACAGCCCTCGGTGGACAAAGCCAGCAGCCGAGCCTTACTTGTCCCACCTGGGCCCACCGGCCTGGAGTGGCATGCCTGGCCTGTCAGTATTTATTGCCTCCATATGTGCCGTCCTCTGGGCCCGCTGGCCTGCCACCTCTGCCCCCAGGCTCGGTGCCACCATCCCTGGCAGGCCCTCCCCGGACCCAGCCAGGACACCCGTGGGACCAAGCATGCACAGTCGGAGCTGTCCCCTGTGCCACCCCTCCCCTCGCTGGTCAGGCCCGGGCTGGAACACAGGAACCCGTCCCTGCTTCTCCTTTTCAGACCAGGAAATAAACTCCCCCC