Transcript asmbl_29758

Sequence
Transcript Sequence for observation asmbl_29758 of TGE0012246:
ACACCAGCACGGAGTCCCCCGACCACTACCTGGTGGACCACTGCATTGACGGCCGCGTCATCTTTCCCGCCACTGGCTACCTGTGCCTGGTCTGGAAAACTCTGGCACACGCCCTGGACCAGAACGTGGAGCAGATGCCCGTGGTTTTTGAGGATGTGACGCTGCACCAGGCCACCATCCTGCCCAAGACAGAGATCGTGGCCCTGGAGGTGCGGCTCCTGGAGGCCTCCCATGCCTTCGAGGTCTCCGACAAAGGCAACCTGATAGTGAGCGGGAAGGTGTACCAGTGGGAGGACCCCGACCCCAAGCTCTTCGACAGCCAGGGTGGCCTGGCTCCAGAGGCGCCGACAGGCCCAGAGGCAACGTCCCGCCTGGCCCCGGGGGACGTGTACAAGGAGCTGCGGCTGTGTGGCTACGACTATGGCCCCCAGTTCCAGGGCATCCACGAGGCCAGCTTTGAAGGCAACACAGGCAAGCTCCTGTGGAGGGACAACTGGGTGGCCTTCCTGGACAGCATGCTGCAGATATCCATCCTGGGCACCAGCCAGCGCAGCCTGCGCCTGCCCACCCGCATCGCTGCCGTGCACATCGACCCCGCCACCCACCGGCAGAAGGTGTACGCCCTGCAGCGCGAGACGCAAGTGGTCGACGTGGTGGTGGACAGGTGTCTACAGAGCACGGTGGCCGGGGGCGTTCTCATCTCGCGGATGCACACCTCGGTGGCCCCGAGGCGGCAGCACGACCAGTCGCCCACCCTGGAGAAGTTCTGCTTCACGCCGCACCTGGAGGCCCGGTGCCTGGTCAAGAGCGCGGCCCTGCAGGAGGAGCTGCAGCTGTGCCGGGGGTTGGCGCGAGCACTGCAGACCAAGGTGGCCCAACAGGGACTGAAGATGCTGGTGCCTGGGTTGGATGGGGCCCAGGCCCCCCGGGAGCCCCCGAAACAGGGCCTGGCCCGGCTGCTGGCGGCCGCCTGCCAGCTCCAGCTCAACGGCAACCTGCAGCTGGAGCTGGGGCAGGTGCTGGCACAGGAGAGGGCCCTGCTGCATGCGGACCCCCTGCTCTGTGGCCTCCTGGATGCGCCGGCGCTCAAGGCCTGCGTGGACACCGTGCTGGAGAACATGGTCAACTTCCGGATGAAGGTGGTGGAGGTGCTGGCTGGTGACGGCCACCTGTACTCCCGCATCCCGGCCCTGCTCCGCATCCATCCCATGCTGCAGCTGGACTACACAGCCACCGACCGCCACCCGCAGGCCCTGGAGTCTGTCCAGGCCAAGCTGCAGCAGCATGGCGTGGCCCAGGGCCAGTGGGACCCCGCAGGCCCCACCCCCAGCGGCCTGGGCCCGGCAGACCTCCTGGTATGCAACTGCTGCATCTCCAGCCTCGGGGACGTGGCCACGGCCCTCAGCAACATGGCGGCCACCCTCAAGGATGGTGGCTTCCTGCTGCTGCACACCCTGCTCAGAGGACACCCCCTCGGGGACACGGTCGCCTTCCTGACCTGCCCCGAGCCGCAGCCTGGAGGGCAGAGCCTCCTGAGCCAGGATGAGTGGGAGAGCATGTTTGCCAAGACGTCTCTGCGCCTGGTGGCCCAGAAGAAATCTTTCTACGGCTCCGTGCTCTTCCTGTGCCGCCGGCTGGCCCCTCCGGAGAGCCCCATCTTCCTGCCTGTGGAAGACACCAGCTTCCAATGGGTGGACCCGCTGAAGGACATTCTCTCCGCGGCCTCCTCCCAGCCTGTGTGGCTGACTGCAGTCGGCTGCAGCACCTCGGGTGTCGTGGGCATGGTCAACTGTCTTCGCAAGGAGCCCGGCGGGCACCGGGTCCGGTGCATCCTGCTGTCCAACCTCAGCAGCACGTCCCCCGTCCCCAAGATGGACCCGAGCTCCCCAGAGCTGCAGAAGGTGCTGCAGGGGGACCTGGTGATGAATGTCTACCGGGACGGGGCCTGGGGGGCCTTCCGCTTCTTCTTGCTGGAGCATGACCAGCCGGAGGAGCAGACGGAACATGCCTTCGTCAACGTCCTCGTCCGAGGGGACCTCTCCTCCATCCGCTGGGTTTGCTCCCCGCTGCGCCACGCCCCAGCCCCCCGCCCCGGCTCTCGCCTCTGCACCACCTACTACGCCTCCCTCAACTTCCGGGACATCATGCTGGCCACGGGCAAGCTGTCCCCTGACGCCATCCCAGGTGCGGGCAGCGTGCGGCGGGGCAGGGGGAGGGGGGTGGCGGGGTCTTGCCACGGCGCTTGGGGTCCAGGAGGCCCCCGTGCCTCAGCCGCCATCTGCCCCCAGGGAAATGGGTCAACCGGG