Transcript asmbl_29643

Sequence
Transcript Sequence for observation asmbl_29643 of TGE0000808:
GTGAGTGTCTCTGTGGCGGGATGCAGGGAATAGGGGGGTAATCCGAGGTACCGGCGCGCGCCCTCCGCCCTCATAGCCATGCCTCGCAAAATTGAGGAGATCAAGGACTTCCTGCTCACGGCCAGACGAAAAGATGCCAAATCTGTCAAGATCAAGAAAAATAAGGATAATGTGAAGTTTAAAGTTCGGTGCAGCAGATACCTTTACACCTTGGTCATCACAGACAAAGAGAAGGCCGAGAAACTGAAGCAGTCCCTGCCCCCCGGTTTGGCAGTGAAGGAGCTGAAATGAACCAGACATGCTGATCTGAACTGCATTAAAATTTTTAAAAATCTT