Transcript asmbl_29635

Sequence
Transcript Sequence for observation asmbl_29635 of TGE0004643:
CGGGGATTGGCTTCTTCCTCGGCTCATAGCAGTTCGCGGCTGCAGTTCGTGGGACACCTGCTAGTTCCTCCGGCGCGGGGGCTTCTTGCCGCGCTCTCTCCAGCCTCCCGGTCCGCAGGGCTGGGTAAAGGGCTGGACCGTCCGGTCTCCGATCCCTTTACAGGACTCCGCGTCGCGCCGCTGAGCCGTCGCAGGGCGAGATGAGCGCGGACGCAGCGGCCGGGGCGCCCCTGCCCCGGCTCTGCTGCCTGGAGAAGGGTCCGAACGGCTATGGCTTCCACCTGCACGGGGAGAAGGGCAAGGTGGGCCAGTTCATCCGGCTGGTGGAACCCGGCTCGCCAGCCGAGAGGTCGGGGCTGCTGGCCGGAGACCGGCTCGTGGAGGTGAACGGCGAGAACGTAGAGAAGGAGACCCACCAGCAGGTGGTGAGCCGCATCCGCGCGGCGCTCAACGCCGTGCGTCTGCTGGTGGTCGACCCCGAGACGGACGAGCGGCTGCAGAAGCTGGGCGTCCAGGTCCGGGAGGAGCTGCTGCGCACCCAGGAAGGGCCCTCGCAGGCCGAGCCGCCGGCCGCCGCCGAGGCGCAGGGGGCTGGCGACGAAAATGAGCCACAGGCCGCCGCGCCGGAACCGGGGGAGGCGGAGAAGAGCCATCCGGAGCTGCGTGAGCTTCGGCCTCGGCTCTGCACCATGAAGAGGGGCGCCAACGGCTATGGCTTCAACCTGCACAGCGACAAGTCCAAGCCAGGCCAGTTCATCCGGTCAGTGGACGCAGACTCGCCCGCCGAAGCCTCAGGGCTCCAGGCCCAGGATCGCATCGTAGAGGTGAACGGGGTCTGCATGGAGGGCAAGCAGCACGGGGACGTGGTATCTGCCATCAAGGCTGGTGGGGACGAGACCAAGCTGCTGGTGGTGGACAGAGAGACCGATGAGTTCTTCAAGAAGTGCAAAGTGATCCCATCTCAGGAGCATCTGAATGGTCCCTTGCCTGAGCCCTTCACCAATGGGGAGATCCAGAAGGAGGCGGCCTCCGAGAACCCCAGACCGATGCTGGCAAGGTCCACCTCCAGTGACACCAGTGAAGAGCTGAATTCTCAAGACAGCCCCAAGGAACAGGACCCCACGGCACCCTCATCTACCTCTTCCTCCTCCGACCCCATCCCGGACTTCACCATCTCCCTGGCCGCGGCCAAAGAGAGGGCCCACCAGAAGCGCGGCAACAAGCGGGCCCCGCAGATGGACTGGAGCAAGAAAAACGAACTCTTCAGCAACCTCTGAGCGCGTCCCCCGGCCACCCGGGAAAGCTGGAGGGCTGGGCCCACACCCCAACTCAGCCCCCTTCCCCTCCCCGCCCCCCACTCACCCACGAATGACTTACAAATCAGCACCAGCATCTCCCCTCTTGGCCAATCTGATTTTTCTAGAGAACTACATGAATGTTTGCCTTTCCTACTCCAATCAAAGAGCAGACTGTCCCCCTCCTCGCAGAGGGCTTCAGCCCACCAGGTGTCTGCTCGCCACCCCTCCCGGGACATCACTGGGAGCTACACCATGCAAGGACCATGGGACTGGGAGAGGGGTCACGGCCTCAAGTGATGACTGGGCCCAGGGTTGGAGGACTTGGATTACAGCAGTAAGCACCTCATCCTGAGAGGGCTGGGTTGGGCATCTTATTTTCGTTCA