Transcript asmbl_29474

Sequence
Transcript Sequence for observation asmbl_29474 of TGE0004615:
GTGCTTTGAACCCGGGGCGGGGGCGGCGGCGGGAGCCGAGGTCGGGGTCGGGATTAGTGTCCGCGTCTGGATCCGGCCCGGGCCGCCGGCACTCCTGGGCGTCCGCTTCCGGGCATGGCGGCCGAGGTGCGCGTTTCGCGCTGGTACTTCGGGGGCCTGGCCTCGTGTGGGGCAGCCTGCTGCACGCACCCGCTGGACCTGCTCAAGGTGCACCTGCAGACGCAGCAGGAGGTGAAGCTGCGCATGACCGGCATGGCGCTGCAGGTGGTGCGCTCCGACGGCATCCTGGCGCTCTACAACGGCCTGAGCGCCTCCCTGTGCAGACAGATGACCTACTCCCTGACCCGATTCGCCATCTACGAGACCGTGCGTGACCAGGTGGCCCAGGGCAGCCAGGGGCCCCTGCCCTTCTACAAGAAGGTGTTGCTGGGTTCCCTCAGTGGTTGCATCGGAGGTCTCGTGGGGACTCCCGCTGACATGGTCAACGTCAGGATGCAGAACGACATGAAGCTGCCCCAGGATCAGCGCCGAAACTACGCGCACGCCCTGGACGGCCTGTACCGTGTGGCCCGAGAAGAGGGTCTGAAGAAGCTGTTCTCGGGTGCGACCATGGCGTCTAGTCGAGGGATGTTGGTGACCGTGGGCCAGCTGTCCTGCTATGACCAGGCCAAGCAGCTCGTCCTCAGCATGGGGTACCTGTCTGACGGCATCGTCACTCACTTCATCGCCAGCTTCATCGCAGGTGGGTGTGCCACGTTTCTGTGCCAGCCGCTGGACGTGCTGAAGACCCGTCTGATGAACTCCAAGGGCGAGTATCAGGGCGTTCTCCACTGCACCATGGAGACTGCGAAACTCGGGCCAATGGCCTTTTACAAGGGCCTCTTGCCCGCCGGCATCCGCCTCATGCCCCACACCGTGCTCACGTTCGTGTTTCTGGAACAGCTTCGCAAACACTTTGGCATCAAAGTGCCGTCCTGATGGGGCCGTGGGAGCGAGCTGGGCCGTGCTGGCCCCCAGTGCCAGTTCTTCCACAGTCCCGGCAAGCCAAGCGCTGCCCTAAGCCCAGCACCTGCCCGCAGGGCTCCAGCCCCCCATTCCTGGCCCAGGACGCCCACCCCGTCCTCCCCCACCTGCCTGGGCTGGAGCTCCTTCCAGGAGCTGTCCCCCCAGCACCCCTCCGCTGTAGCTTCGCCTTGGCCCTCCCTACCTGGCACCCCAGTGGCCCCATCCACGCACCTGTGCCTCACTGGGAGGGGCGGGCTCCAAGTGCAGGTTCAGGCTTCTCCCCTCCCCGAGCAGTCAGCCCTGGCGGGGGAGGGGCAGGCTCCAGGCTTTCTGGGGTCCCCCGCCCCTTCGCCTGAGGCGTTTCTTTCACCGAGCAGCTGCCCAGGGCTCACAGCACCGTCTTCCAGCAGCTTCTTTCAAGGACCTGGGAGGCAGAGCGGGGGGAGTGCAGACCCCCAGCATTGCCCACCAAAGCGTGTGCCTGCACGCGCACTTTATCCTAGGAAAGGGACCATAGCTTTCGTGACGTTCTCGAAGGTAGCTGTGCCCCTGCGCTGCTGGGCAGGTGGCGGAGGAGGCAGGGAACGCAGGGTCTGAGCTGTGGGCCCCTCAGGCCCGTCCCGCCCCAGCCAACCCCCTGTTGCTCTAAGGGTTAGTTTCACCAAAAACCTCAGCGCCAGAGGCGCTGCTGTCTGCAGGGAGCGGAGTGTCTCTCACACCGTCCACGCTGTCCCCTCCGGCCCCCGGGGCAGAGGCGGGCTGTGCCGCGTCCTCGGGGCCCCTCTCTCTGTGGACAGCGATCACCCTTCAGGGCCCCCAGCAGCTGACCAGCCAAAACACCGCCGCCCAGGTTCTGCTGCCAGAGCAGCCTGACCCTGCAAATGGGCCTAGGGACTGTGTCTTCACCCCGGTAGGGGGCCGGCCCACAGGGACACTAATAAAGGACAGGAGCTGCTGTGCGTCTAGTCCTTGCAT