Transcript asmbl_28614

Sequence
Transcript Sequence for observation asmbl_28614 of TGE0004596:
AAAGCGGCAGCAGCGGCTCTAGCGGCAGTAGCAGCAGCGCCGGCTTGCTGTGCGGAGGTTCTCCTAGCGGTGTTGTTTCTCCAGCGGCGGCAGTTCTCACTACAGCGCCAGGACGAGTCCGGTTCGTGTTCGACCGCGGAGATCTCTCTCATCTCGCTCGGCTGCGGGAAATCGGGCTGAAGCGACTGAGTCCGCGATGGAGAAAACTTTAGAAACTGTTCCTTTGGAGAGGAAAAAGAGAGAAAAGGAACAGTTTCGTAAACTCTTTATTGGTGGCTTGAGCTTTGAAACCACAGAAGAAAGTTTGAGGAACTACTACGAGCAATGGGGGAAACTTACAGACTGTGTGGTAATGAGAGATCCTGCAAGCAAAAGATCGAGAGGATTTGGTTTTGTAACTTTTTCATCCATGGCTGAGGTCGATGCTGCCATGGCTGCAAGACCTCATTCGATTGATGGGAGAGTGGTTGAGCCAAAACGTGCTGTTGCAAGAGAGGAATCTGGAAAGCCAGGGGCTCATGTAACTGTGAAGAAGCTGTTTGTTGGTGGGATTAAAGAAGATACTGAGGAACATCATTTTAAAGATTACTTTGAGGAATATGGAAAAATTGATACCATTGAGATTATTACTGATAGGCAGTCTGGAAAGAAAAGAGGCTTTGGATTTGTTACTTTTGATGACCATGATCCTGTGGATAAGATTGTGTTGCAGAAATACCATACCATCAATGGTCACAATGCAGAAGTAAGAAAGGCTTTGTCTAGACAAGAGATGCAGGAAGTTCAAAGTTCTAGAAGTGGAAGAGGAGGCAACTTCGGTTTTGGAGATTCTCGTGGTGGCGGTGGAAATTTTGGACCAGGACCAGGAAGTAACTTTAGAGGAGGATCTGATGGCTATGGAAGTGGTCGTGGATTTGGGGATGGCTATAATGGGTATGGAGGAGGACCTGGAGGTGGCAATTTTGGAGGTAGCCCTGGTTATGGAGGAGGAAGAGGAGGATATGGTGGTGGAGGACCTGGATATGGCAACCAGGGTGGGGGCTACGGAGGTGGTTATGACAACTATGGAGGAGGAAATTATGGAAGTGGAAATTATAATGATTTTGGAAATTACAACCAGCAACCTTCTAACTATGGGCCAATGAAGAGTGGAAATTTTGGTGGTAGCAGGAACATGGGAGGACCATATGGTGGAGGAAACTATGGTCCTGGAGGAAGTGGAGGAAGTGGGGGTTATGGAGGGAGAAGCCGATATTAAGCTTCTTCCTATTTGCCATGGGTAAGTACTTTTAAGTTTACATTATTATTACCTTGGGGAGACCTAGCGGCCAGGAGTAAAAGCTTTTTAGGATCATGTTATCTTTCCTTAAAATCTGGTTAGATGGATAATTTCATAACCTATTTTTTTTTTACTCTTTACTTCTGTTGAAACAGGCTTCACTGTATAAATAGGAGAGGATGAGAGCCCAGAGGTAACAGAACAGCTTCAGGTTATCGAAATAACAATGTTAAGGAAACTCTTATCTCAGTCATGCATAAGTATGCAGTGATATGGCAGAAGACACCAGAGCAGATGCAGAGAGCCATTTTGTGAATGGATTGGATTATTTAATAACATTACCTTACTGTGGAGGAAGGATTGTAAAAAATGCCTTTGAGACAGTTTCTTAGCTTTTTAATTGTTGTTTCTTTCTAGTGGTCTTTGTAAGAGTGTAGAAGCATTCCTTCTTTGATAATGTTAAATTTGTAAGTTTCAGGTGACATGTGAAACCTTTTTTAAGATTTTTCTCAAAGTTTTGAAAAGCTATTAGCCAGGATCATGGTGTAATAAGACATAACGTTTTCCTTTAAAAATTTAAGTGCGTGTGTAGAGTTAAGAAGCTGTTGTACATTTATGATTTAATAAAATAATTCTAAAGGAAATTGTGTAATTATAGACTTTTTATTTTAAATAAGTTAAGGAGTGGGTAGTATAATTAAGGTCCATTGCAAAGCTGTTATATTTGTGTAAGATAAATGCTGGTCAGATGTAAGTGTGTTGTCTGCAATTCATCAGGATTAAATTATCTAGATAACTTAAGGGATATCTCTGCAAGGAGAAACACCTTTTTAGATCTTTTAGATGCTGCTTCTTCAATGCAAGGAAAGGAAATAACCCCAGCGAGGTACTCTTCAGGGATACAGGTCTAGTACAAGAAAACTTGACGGCTACTAAGTTCAGCCAGTCTTAAAAAACTGTGCTGTTTCTACAAAGCTTTAACTACAGTAGTTTATAAGGATGCCAACGAAAGCTGAGGGTGTAGAGCAAAATAGTTCTAAGCTTCAGTTAAACTTCTTTAGGTAAGATCTCATTTACTTTTTCTTTCTTAATTTTCCTCCCCAAAAGATAAAACTAATACTCTTCAATGGTCTTCCAGTATAGTGGTTCTTATGTAGTTTAACATAGCTGTAAAATTGAGTTTAACAATTTATAAACTCAAGAGAATAATTTTATACACCCTTGTTTTCCAATCTGTCATTTAAATTATTTTGGTTGTTTTTTCCCTTTTTCCTTCTTTCCCACCCCCTCCCCCTCTATGAAGATTCAGGTGCTTAACATATCATTTTTTTCCCTGCTGGAATTTTA