Transcript asmbl_28604

Sequence
Transcript Sequence for observation asmbl_28604 of TGE0004593:
AGGTAATTCGGAGCTCTCAAAATGTTTGCCAAAGCAACAAAGAATTTTCTTAGAGAAGTTGATTCTGGAGGTGATCTGATTGCAGTATCGAACTTGAATGACTCTGATAAGTTACAACTTCTAAGCCTAGTGACCAAAAAAAAGAGATTCTGGTGCTGGCAGAGACCAAAGTATAACTTTTTATCTGTCACCCTTGGAGATGTGCTCATAGAAGACCAATTTCTGAGTCCAGTGGTCGTGGAGTCGGACTTTGTGAAATACGAGGGAAAGTTTAAAAACCACGTGAGTGGAACCATCGAGACGACACTGGGGAAGGTCAAGTTGAATATTGGAGGCAAAGGCCTTATGGAGAGTCAGTCTTCATTTGGAACCCTGAGGAAACAGGAAGTGGACTTGCAGCAGCTCCTCAGGGATGCCGTGGAGAGAACGATAAATCTGAAAAACCCTGTGCTGCAGCAGGTGCTGGAGAGGAAGAATGAGGTCCTGTGTGTCCTGATACAGAAGATAGCGACAACGCAGAAGTGCGTGATCTCTGAGCGCATCCAGGTTGAGGAGAAGTGCGGTGGCATCGTGGGGATCCAAACCAAGACGGTGCAGGTGCAGGCCTCCCGGGGCGGAGGTGCAGGCCTCTCGGGGCCAGAGGTGTCTGCTGCGGAGGATAGGGCTGTCACCAAGGACACCAACGTGGTGTTGGAGATCCCAGCTTCCACCACCATTGCCTACAGTGTCATCGAGTTGTATGTGAAAGTGAATGGCCAGTTCGAATTCTGCCTCCTACAAGGAAAGCATGGTGGCTTTGAGCAAGAGAGAAGAAGCAACTCTGTCTCCCCGAGCTCCCTGCCCTTTCAAGAGTTTGCGTTTAGCGACATGCCAGATGCCTGGCAGGGGCCGCCTGCCTCGGATAAGCCACTGAGTGTTTTAAAAGAAGTGACTCTGCCCTTGGAGAAGAGTTTCCGTCCCTTCGCAGAGCTGCCCGAGCAGCAGCAGACGGCCTTGAGCGGCATCCTGCAGGCGGTCCTGTTTGATGACGAGTTACTCCTGGCCTTGGAGCAAGTGTGTGACGATGTGTTCAGCGATCTGTCACCCCCACGGGTGATACCTGGAGAGCTGAAGCCCTCACAGCAGCAGGACCTCATGGCCTTCCTGCACCTGGTGGGGTACAGCATGCAGAGTGGGTGTCCGGGCCCGGAGGATGCTGTCAGCAACCAGAAGCTCTTCTCTACGGCCTACTTCTTGGTCAGTGCACTAGCAGAAATGCCAGATAATGCAGCAGCTCTTCTGGGCACGTGCTGTAAACTCCAGATTATTCCTACGCTGTGTCACCTGCTCCACGTGCTGTCTGCTGATGGAGAATCTGATCTTGAAGACGCAGCCCTGGCTCCTCTGAGAGATACAGAGAGGTTTGAGATTGTGCAGCGCCTGCTTGCTGCAGCTGACATTAACCTGGAGCGACAGCAGTCGTCCGTGAAAGCTGTCACCTGCCAAGTTCCTAACGTTTCCCCGCTCGTTCTTTATATAAGCCTGAATGGACTCTGGGCTTTAGGCAGAATGCATCAGTAACGTCACACGTGAATCATGAGGACATGTTCTCGGCCAAGGCTGGGTAACTTTCAGGATCGTTGAGATACTACTTTGGGGCCTAGGTCAGATCTATGTTGAAAGATGCTCAAGGAAATGAATTTACAAGAGTCTATGGAGTGGTAACTTTTTACGCTAGGAATCGCCTTGAGTTTAGCCACCAGGTACTCTGTTTCTGTTTCATACGAGGCCCTCCTGTGCTGGTCACCCCATGTGCAAGTTCAACTCCAGCACCCGAAGGCCTGGGGAAGGGATGAGAATTCTAAGCCAGAGTACATTCAGACCTTTTTTTTCTGGAGCGGCACTGAAAAAAATGGGTCCATCTATCACTTACATTTCCCTCTTTCTTCCTGTTGTACCAAAACAAATGGGTCTGCCACTTTGATCCAAAAATTCACTTTAAATTGTGAACGTTGTGGAAGGGCAATTTCTCTTCATAGAAGGCTACGTTTTGGACGTGCTATATGCCTTGCAGTGACTGAAAAATGAACTGTAAGTGCCACTAGAGCACATATATTCTTCTGCTAAACAAAATTATACTAGAAAAATCTAATAGCAGGGCACCTTTCCTTAAGGGTCTAGCTATATGCATTTTATTTGGCTTTGATGAACATAATAATTCTCTGTCAAGAACAATGTGCTAGTATCCCATACAATCTTGATGT