Transcript asmbl_27437

Sequence
Transcript Sequence for observation asmbl_27437 of TGE0004542:
GAAAAGGGTAAAGGAGCGACTCCAGCCCGCCGCTTCCTCAACTTGGGGCTCGCTGTCTCCGGCTCCGCTCGGGTAAGGGGCTCTGCAGCGACGTGCGCGGAGAGGGGCCACCGTGGGAAACTGGCCCCAGAAGAGCCAGGGCGGACTCCTGCTTCCAAGAGTCTCCGGCTTGTCGCTCCTCACGGCCCAGTGCCCCCTCCATCAGGTCCTCCAGCCAGAGGACAGGCATGGCGAGGCCGGGAGGCTCCTGCCTTTGCAGCTGTTTGGCTGTGCTCTGCCTCCTCCCCTCGCTGAGCCTGGCGCAGTACGAGAGCTGGCCCCACTACCCCGAGTACTTCCAGCAGCCGGCTCCCGAGTACCACCGGCCTCAGGTGCCCTCCGACGTCACCAAAATCCAGCTGCGCCTGGCGGGTCAGAAGAGGAAGCACAGCGAGGGGCGGGTGGAGGTGTACTACAACGGCGAGTGGGGCACCGTGTGCGACGACGACTTCTCCATCCACGCGGCGCACGTCGTCTGCCGGGAGCTGGGATACGTGGAGGCCAAGTCCTGGACCGCCAGCTCCTCCTATGGCAAGGGGGAAGGCCCCATCTGGTTGGACAATATCTACTGCACTGGCAAAGAGGCGACCCTTGCAGCCTGCTCCTCCAATGGCTGGGGTGTCACCGACTGCAAGCACACAGAAGACGTGGGTGTGGTGTGCAGTGACAAAAGGATTCCTGGGTTCAAATTCGACAATTCCTTGATCAACCACATAGAGAACCTGAACATCCAGGTGGAAGACATCCGCATCCGAGCCATCCTCTCCGCCTACCGAAAGCGCACCCCTGTGACGGAGGGCTACGTGGAAGTGAAGGACGGCAGGGCCTGGAAGCAGATCTGCGACAAGCACTGGACGGCCAAGAATTCCCGTGTGGTCTGCGGCATGTTTGGCTTCCCTGGGGTGAAGACGTACAACACCAAAGTGTACAAAATGTTTGCTGCCCGGAAGAAGCAGCGCTACTGGAGGTTCTCCATGGACTGCACGGGCACAGAGGCCCACGTCTCCAGCTGCAAGCTGGGCCCTCGGGTGTCCCGGGACCCCGTGAAGAACATCACCTGTGAGAATGGGCTGCCGGCTGTGGTGAGCTGTGTGCCTGGCCAGGTCTTCAGCCCTGATGGACCCTCAAGATTCCGGAAAGCTTACAAGCCAGAGCAACCCCTGGTGCGGTTGAGAGGTGGTGCCAACGTCGGGGAGGGCCGCGTGGAGGTACTCAAGAATGGAGAATGGGGTACCATCTGTGACGACAAGTGGGACCTGGTGTCTGCCAGCGTGGTCTGCAGAGAGCTGGGCTTTGGGAGTGCCAAAGAAGCCATCACTGGCTCCCAGCTGGGGCAAGGGATAGGACCCATCCATCTCAATGAAATTGAGTGCACGGGGAATGAAAAGTCCATCATAGACTGCAAATTCAATGCTGAGTCTCAGGGCTGCAACCATGAGGAAGATGCTGGTGTGAGATGTAATATCCCCGCCATGGGCTTCCAGAAGAAGCTGCGCCTGAACGGGGGCCGAAACCCCTACGAGGGCCGGGTGGAGGTGCTGGTGGAGAGGAACGGGTCCCTCATATGGGGGACGGTGTGTGGCGAGAACTGGGGCATTGTGGAGGCCATGGTGGTCTGCCGGCAGCTGGGCCTGGGGTTCGCCAGCAGCGCTTTCCAGGAGACCTGGTATTGGCACGAAAACATCAATGCCAATAAAGTGGCCATGAGCGGAGTGAAGTGCTCTGGAACGGAGCTGTCCCTGGAACACTGTCGCCATGACGAGGATGTGGCTTGCCCCCAGGGCGGAATGCAGTACGGAGCTGGAGTCGCCTGCTCAGAAACCGCCCCTGACCTGGTCCTCAATGCGGAGATCGTCCAGCAGAGCACCTACCTGGAGGACCGACCCATGTTCATGCTGCAGTGCGCCATGGAGGAGAACTGCCTCTCGGCCTCGGCCGCCCAGACCAACCCCACCTCAGGCTACCGGCGGCTGCTTCGCTTCTCCTCCCAGATCCACAACAATGGCCAGTCCGACTTCCGGCCCAAGAACGGCCGCCATGCGTGGATCTGGCATGACTGCCACAGGCACTACCACAGCATGGAAGTGTTCACCCACTATGACCTCTTGAACCTCAATGGCACCAAGGTGGCAGAGGGCCACAAAGCCAGCTTCTGCTTGGAGGACACAGAATGTGAAGGAGATAGCCAGAAGAGCTACGAGTGTGCCAACTTTGGTGAGCAGGGCATCACCATGGGCTGCTGGGACGTGTACCGCCATGACATCGACTGCCAGTGGGTGGACATCACAGATGTGCCTCCCGGAGACTACTTGTTCCAGGTTGTCATCAACCCCAACTATGAGGTTGCAGAATCTGACTACACCAACAACATCATGAAATGCAGGACCCGCTACGACGGCCACCGCATCTGGATGTACAACTGTCACATAGGTGGTTCCTTCAGTGAAGAGACAGAAAAGAAGTTTGAACACTTCAGTGGACTCATAAATAACCAGCTCTCTACGCGGTAAGGCAGCCTACATGGTCACGTGGTCACCTCCTGCCTTTGGGCCACAGCGCATCTTCCCCAACAACTGCAGTCCGACGGACGATCACCACACTCCCCCTCGCCTAGCCCGGCCCCGCCCCATCTGGATACCCTGCGGCCACATCTCAGCTCAAGAGGAATGGGTGTTCCTGACATTTGCTGGGGGCTGCTGCCTGAGCCTGGGAAGGTGTCTGGGAGTGGGCCTTGTCCGCAGGGCTGTGGGAGCAGTGCCACGGGCCATCTTGTCCGGGACCCCAGGCACACAGGTTGTCATCAGCTTGTCCCATCCAAACCAGTCACACCTGCCCCACACCCCACCCCATCCCCAGTCTGACACCACCCCCATCAGCTCACCACAGATAATATGGGGCCATTCTCTCCTCAAATTCCATGTCGGCAAAGCCAGTTTATCGCCCGAGGTGGTCAGGCTGAATCCCATTTCTCCTCCTCTTGGGTCATCTGCAACCAACTTGAACGTCTAGAGCTCTCTTCCAGTTAAACGAACTGCCTGTCCTCTCCTCTCTCTGTTCACGTATATAAAAAATGCTGCCACATTTTCTGATGAAGTGAGCTCAGAGCTGGTACTTCTCCCCTACCCTCAACTCTACATCCTATTTTTCAAGATACCATTATTATATTTTCACGAACTTTGAAACACAAATTAATTTAGTGGCATTTAATATTGGGCATCTGGGCCTTTGGAAGGAAAAACCTGCCCACCTGTGTAAGTGACTCATGGTTCTGTTGTTCTGATTCTGTGGGTAACTGATTCAACGGTGCTATAACCAGGGTCCTGGGTGACAAGGACACTCACCAAACGCCATGTGTCATCACAGACACTTACACATACTTGAAACTTGGAATAAAAGATTTATGATTTG