Transcript asmbl_10736

Sequence
Transcript Sequence for observation asmbl_10736 of TGE0000015:
GGGAGGGAGCGAGGGAGGGAGCGAGGGAAGGGAAAGGCGAGCGTGAGCTGCCTCAAATGCTTGGAATAATTCCGCTTCCGTTTGGAAAGCCGCAGCCTCAGTCCCGCCGCCGCCCGCTGCGTCCGCCCAGCGCCAGCTCCGCGTCCCGACCGGCCCGCGGCAGCCTGCGCCGCGCCATGGCCACCTCCCCGCAGAAGTCGCCTTCTGTCCCCAAGTCTCCCACTCCCAAGTCGCCCCCGTCCCGCAAGAAAGATGATTCCTTCTTGGGGAAACTCGGAGGGACCCTGGCCCGGAGGAAGAAAGCCAAGGAGGTGTCCGAGCTGCAGGAGGAGGGAATGAACGCCATCAACCTGCCCCTCAGCCCAATTCCCTTTGAGCTGGACCCCGAGGACACGATGCTGGAGGAGAATGAGGTGCGAACAATGGTGGATCCAAACTCACGCAGTGACCCCAAGCTTCAAGAACTGATGAAGGTATTAATTGACTGGATTAATGATGTGTTGGTTGGAGAAAGAATCATTGTGAAAGACCTAGCTGAAGATTTGTATGATGGACAAGTCCTGCAGAAGCTTTTCGAGAAACTGGAGAGTGAGAAGCTAAATGTGGCTGAGGTCACCCAGTCAGAGATTGCTCAGAAGCAAAAACTGCAGACTGTCCTGGAGAAGATCAATGAAACCCTGAAACTTCCTCCCAGGAGCATCAAGTGGAATGTGGATTCTGTTCATGCCAAGAGCCTGGTGGCCATCTTACACCTGCTCGTTGCTCTGTCTCAGTATTTCCGCGCACCAATTCGACTCCCAGACCATGTTTCCATCCAAGTGGTTGTGGTCCAGAAACGAGAAGGAATCCTCCAGTCTCGGCAAATCCAAGAGGAAATAACTGGTAACACAGAGGCTCTTTCCGGGAGGCATGAACGTGATGCCTTTGACACCTTGTTCGACCATGCCCCAGACAAGCTGAATGTGGTGAAAAAGACACTCATCACTTTCGTGAACAAGCACCTGAATAAACTGAACCTGGAGGTCACAGAACTGGAAACCCAGTTTGCAGATGGGGTGTACCTGGTGCTGCTCATGGGGCTCCTGGAGGGCTACTTTGTGCCCCTGCACAGCTTCTTCCTGACCCCGGACAGCTTTGAACAGAAGGTCTTGAATGTCTCCTTTGCCTTTGAGCTCATGCAAGATGGAGGGTTGGAAAAGCCAAAACCGCGGCCAGAAGACATAGTCAACTGTGACCTGAAATCTACACTACGAGTGTTGTACAACCTCTTCACCAAGTACCGTAACGTGGAGTGAGGGGCTGCCCTGGGCCCACCACTGCCCAAGAGTTCTTGCTGTTGGCGTACTGGACCCTCCTCCGAACTGCCTTACCCTGCTTATTCCTGTCTCTTGCACTGTGCTCTCCCACAAGTCCAGCTGCAACCCAGAGATAGTGGAAACTGAAATTAGGAAGGAAATCATCAATAACTCAGTGGGCTGACCCATCCCTCCCAGGCGCTGGGGACCAACCTAGCAATGAAGGTTGGGAAGGTTGTTCCCTTCCCGGTGCCAGGTCCAGATTTCCCTCCATGATTTGGGAACCAGCTTAGGCAAAAGAGTCCCCACAAGATGAAAATAAAGATCCTAGTTACCATTCAAAGGATGCTAACTGTGTGTCAGGCCCCACACTAAGTGCTCTGCTCTGATATACTCAAGGCCATTAATCTTCAGGACTCCCATTGACGTAGGTGTTTCATTCCCCTTTTACAGATGAGGAAACTAAGGCTTGGAGGTTAAATGACTTGCCAGAAGTTGGAATTTTTTTCCTCTTTGAACATAACCTCTCCCTTCTCCCTAAAGGTAACCACTATTCTGAGTCCAATCATCAAGGTTTTGCTTTTCTTTTTAGCTAAGTATGCATTCCTCAATAGTAGACAGTACAACATGTTTATAACAAGCCAATTACATTATGTTCTTTGCATGTTCTAAAGTTGTGTATGTGTGTGCACATCTGAGCACGTGCACATGTACACCTGAGCCAAAAACACGAGAACCCACTGATCTCACCACTGGGGCAAGCTAGGTCAGAGCTTAGTGATTCACACTGAAATTGGCAAATTGGATTTAACCCAATTAATAGTGTGTGTGTGGCAGGAGTCATGTCCCTCACATCCTTTGTACAAATGAAAATTACTCTTAATTCCTTCAGATTTATAATAACTCTGTACTTTGGTTTCAGGGTGACATTTGGGAAGGATTTTGTTTAGAATTAATGGAGTGGCACATTTTGCAGCCTTTTTGCTTGATTGCATGTAATGGAAATGCCCTATATTTTCCTGCAAAATAAGTACTAAATTCATTATCGTTAAGCAAATGTACAATATGCTCAGGCACCGCAGAGAGCTGGGCACGGGCCCATGTGAGCATCACTTTGGAAGTAGGGCTCTTCAACAGGGACCCTTGAACTTTAAAGAAAGGAACTTCTTTTTGCCTTCTAATTGATCATTTAGACTATTCTGGCTAAGTCTGCCCACATGTAATTACCGGCTAATTCAAGCGAGGAAAAATGTAAGTCATTTAGACCAAAGCCAAGCAGTTTCTTTGCGTGGGTTACTCAAGGGCTTGTGGTTACTTGTATCTCCTCTATGTGAACTTGACTTTGAAAGACAGAGCTCTAGTGTGCCAGCCTGCTAAGTCCTGTAAGAATAGGGAAGGGCGGAGGGGGGTGGGCAGTGACTAGGGGACGAGAAGCATGGGGAAAATATTTGCACTCTAAACATACAGAGATAGAGGTGGGGCTTGTGGTACTTAACACTTGTAGCCATCAACTGACTGAGACCTTGGGCTAAATAATCAATTGTGCTGATATTACATCTCGTTATGGAATGTTCCTAAATATGCCAGGTAGACACCAGCCCAAGTACCCTCCTCCAGAAGTCTGTGACTACCTTGTCACTACTTTAGGCCCATTCCACAAAGCCCATCTCTGGTTTGAGAATTCATTTTGATCTGTATCTACACCACCCAAAGTTAGGCCTCCTATAATGTCCAAAACATTCCTTTCAGCCTTTTTATTTCTTACTGTACTGTCTCTTACTGTACTGTCTATCTGCAGTAATTGAGGACCCATAAAATTTAGATAACTACATGTCTTTGCTCTTAGAATTGTCACTCAGCATAATGAGCATTTAACATACAAAGGCAATGTACTGTTTTGTGTTGATCTATGTAAAAG