Transcript asmbl_26592

Sequence
Transcript Sequence for observation asmbl_26592 of TGE0004497:
GTAAGGGACCTGGAAACCAAGAAGTGACTGCTCATCTAATCCGCTAAAGCTATGTTAGCAGATTGGAGCTGTTTGCAGACAAAGTTCCAAAGACAGCAGAAAACTTTCGTGCTCTGAGTACTGGGGAGAAAGGATTTGGTTATAAAGGTTCCTGCTTTCACAGAATTATTCCAGGATTTATGTGCCAGGGTGGTGACTTCACACGCCATAATGGCACAGGTGGCAAGTCCATCTATGGGGAGAAATTTGATGATGAGAATTTCATCCTGAAGCATACAGGTCCTGGCATCTTGTCCATGGCAAATGCTGGACCCAATACAAACGGTTCCCAGTTTTTCATCTGCACTGCCAAGACTGAATGGTTGGATGGCAAGCATGTGGTCTTCGGCAAGGTGAAAGAGGGCATGAATATTGTGGAGGCCATGGAGCGTTTTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAACTCTAATAAATTTGACTTGTTTTATCTTAACCACCAGACCATTCCTTCTGTAGCTTGCGAGAGCACCCCTCATCCCGCCTGCTCGGAACACCCTGTTATAATCGGCTCTCGCTGCGGTTCTTTGGGTTCCGGGTTTTCCTTGTACCTCCACGTCTAGCTGGGTTGCAGAGTTAAGTTTATGATTATGAAATAAAAGTTAAACAACAGTTGTCTGTCCTTGTTTGGGTTAGGGTGTTGATGTAGGCTTCATTTTAAGCAGCAGCAGGTTCTAAGCCACGTGCTATGTTTGCTTAATTCCACAGAGTACTGTGTTTTGCTTCCCTGACCCAAGAATTAAATGTCACTGAGTATCTTCAAGGTAATCTGAGTGGAATACCGAAGGTGAAACGGGGACCAGGTTGGGCCAGTGCTCCTTGAAGAAAGTCCCACTTGGCATGTTCAGAGGTATCTATTAAAATTAATGTTATAACAAGTTG