Transcript asmbl_26369

Sequence
Transcript Sequence for observation asmbl_26369 of TGE0004477:
GGGAACTACCGCACCCAGATGTGGGATAAGCACAAGGAGGTCTTCCTGCCCTCGACCCCCGGCCTGGGCATGCACGTGGAGGTGAAGGACCCTGAAGGCAAGGTGGTGCTCTCGCGGCAGTATGGCTCCGAGGGGCGCTTCACCTTTACTTCCCACACCCCTGGCGACCATCAGATCTGCCTGCACTCCAACTCTACCAGGATGGCGCTCTTCGCTGGCGGCAGACTGCGTGTGCACCTGGATATCCAGGTCGGGGAGCATGCCAACAACTACCCAGAGATTGCTGCCAAGGACAAGCTGACAGAGCTGCAGCTGCGGGCCCGCCAGCTGCTCGATCAAGTGGAACAGATCCAGAAGGAGCAGGATTACCAGCGGTACCGAGAAGAGCGCTTTCGTCTGACCAGTGAGAGCACCAACCAGAGGGTCCTGTGGTGGTCCATCGCTCAGACCGTCATTCTCATCCTCACTGGCATCTGGCAGATGCGTCACCTCAAGAGCTTCTTTGAGGCCAAGAAGCTGGTGTAGCGTTCTCTCTGTGTGACCTTTCTCTCTCATCTCAATTATTTGTTCTGGTGACTTCCGCAGCAGCTCAGGATTTCAGCGGGTCGCACAGCCGACGCCCCAGCTGCTCTCAAGGCCTTAGCAGAGGGCTAAGGAGACCCTCTGGGACACCTGTGCCTCCACCGCACGGGGCCTCAGGGTGATGACAGAGCCGGCACTGGCGGGGCGCTCCTCTCTTCCTCGCCCCTTCACCTGTGGTTAAGCCGTGGTAAATGTTTTCTTCAAGGGAACCAGGGTTGGTTCTTTATACAGATTTTTCCAGTGAAATAAAACTTGTTGCAGTA