Transcript asmbl_25115

Sequence
Transcript Sequence for observation asmbl_25115 of TGE0004427:
NNNNNNNCCAGCCCGGGCCGGCGCGGCAGGGAGAACGCGGGAGCCAGGGCGACGCTCTGGGCTCTTCTTTCAAAGTTCAACCCGAGCCGCCGCATTTCCCCGCTGCCCCTTGGTCTCAGGAAATTGCACGAACTGTACACCCTGCCTCCTCTCCCGGAGCAGACTTTGGACCTGTCCTCAACGGCCCCGTGCGGATTTCCTGGGCCCATTTGAAATGACGTTCTCGTCTTCCTGATCCCTAGGATCCGTCGACATGAATCCCGTCGTCGTGGTCCACGGCGGCGGAGCCAGCAACATCTCCAAGGACCGCAAAGAGCGGGTGCGCCAGGGCATCATCCGAGCCGCCACCGTGGGTTACAACATCCTCAAGGAGGGAGGGAGCGCAGTTGACGCTGTGGAAGGAGCCGTGACCGTCCTGGAAGATGACCCCGAGTTCAACGCAGGTTGTGGATCTGTCTTGAACGTCAATGGTGAAGTCGAAATGGATGCCAGTATCATGAATGGAAAAGACCTGTCTTCGGGAGCTGTGTCTGCAGTCCGGTGCATCGCAAACCCCATCAAGCTTGCGCGGCTTGTTATGGAAAAGACACCTCATTGCTTCCTGACTGACCAAGGTGCAGCAAAATTTGCTGCAGACATGGGGATTCCAGAAGTTCCCGAGAAGCAACTGATAACAGAGAGAAACATAAAACACCTAGAAAAAGAGAAGAATGAGAAAAGTGCTCAGAAAACAGACCAACAAAAAAACTTGGGAACTGTGGGCGCCGTCGCCTTGGACTCCGAAGGAAACGTGGCTTACGCGACCTCGACGGGGGGCATCGTGAATAAGATGGCCGGCCGAGTCGGGGACACGCCGTGTATAGGATCTGGAGGTTATGCTGACAATGACATTGGAGCCATTTCCACGACGGGGCACGGGGAAAGCATCCTGAAGGTGAATCTGGCCAGACTCACGCTCTTCCACAGAGAACAAGGAAAGACGCTGGAAGAGGCCGCTGACTCGTCGCTGGGTTACATGAAGTCGAAGCTCAAAGGTTTAGGTGGCGTCATCCTGATCAACACAGCAGGAGACTGGGCAGTAAAGTGGACCTCGGCGTCCATGCCCTGGGCCGCCGCCAAGGACGGCAAGCTGCACTCCGGCATTGACCTTGACGAAACCAGTATTGCTGACCTGCCCTAAGCCCCTGGGAGATCGTGTGCTAGGTGCTAGCGTGGAGGTAAAGTGCAGCTTCCTGACGTGGAGACTTAGCTTAACCAATTAGATCTAGAAATGGAAAAAGCCTACAGTCTGTCACTCGTTTCGTTGCCTTGATCAATAAGCACCCGAATGTGTGGCGAGGGGCGGATTCCACAGTGACAGAGAAATCACAGCTGGGGGCCGCCGGGCTTGCTGGCGCCTACGACTCAGGTCGTTCAACGAACCTGCGTTGTGACGACTGAGGTGCCCGTTGCTGGGCTGACCCAAGCCTCATCTCTCCCTGCCCTTTGTTTCCCAAAAGGCCGGGGTCTGAGCTCCCGCAGATTGTCCTGAGTTTCCGGTCAGTGGACTGACCGCATCCTCCCAGACCTCGTTGCACAGATACCTCCACTTTAAGAATTCTTTCACTTTGTTCACAAAACAAAGAAACCACAACAACCCTCCCTCCCCACCCCATCACCCAGAAATCCCCAAGCAACCAACCAACGAAAACCCAGCTGGTCTCCGTCTCCCTCGTTTCCTTCTAGAGAGTCGCTCTCCTAAATAAATACCTTAAGCTCGATGACTGACTCCCATCGCCCTTTTTCTGGCACAATCCCATCCTCGGATGGCCCGAGTCTCAGCCTTGCGCGACCACACGGCTCAGGCGGGCTGGAGGCCATACCCCATAGCGGTCCAAGGGTGGTACCGGACCTTCGAAACGGCCCCCACGCCAGATCGGCCACAGCCGTGGTCCAGGGGTCATCGACGTGCGTGTGCCTCCGGTGAGAGCG