Transcript asmbl_31601

Sequence
Transcript Sequence for observation asmbl_31601 of TGE0001388:
ACCTTTCCAGAGATGTGACAGAAGCTCTAATTCTGCAACTCTTTAGCCAGATTGGACCTTGTAAAAACTGCAAAATGATTATGGATACAGCTGGAAATGATCCCTATTGTTTTGTGGAGTTTCATGAGCATCGTCATGCAGCTGCAGCATTAGCTGCTATGAATGGACGGAAGATAATGGGTAAGGAAGTCAAAGTGAATTGGGCAACAACCCCTAGCAGTCAAAAGAAAGATACAAGCAATCATTTCCATGTCTTTGTTGGTGATCTCAGCCCAGAAATTACAACTGAAGATATAAAAGCTGCTTTTGCACCATTTGGAAGAATATCAGATGCCCGAGTGGTAAAAGACATGGCAACAGGAAAGTCTAAGGGATATGGCTTTGTCTCCTTTTTCAACAAATGGGATGCTGAAAACGCCATTCAACAGATGGGTGGCCAGTGGCTTGGTGGAAGACAAATCAGAACTAACTGGGCAACCCGAAAGCCTCCCGCTCCAAAGAGTACATATGAGTCAAATACCAAACAGCTATCATATGATGAGGTTGTAAATCAGTCTAGTCCAAGCAACTGTACTGTATACTGTGGAGGTGTTACTTCTGGGCTAACAGAACAACTAATGCGTCAGACTTTTTCACCATTTGGACAAATAATGGAAATTCGAGTCTTTCCAGATAAAGGATATTCATTTGTTCGGTTCAATTCCCATGAAAGTGCAGCACATGCAATTGTTTCTGTTAATGGTACTACCATTGAAGGTCATGTTGTGAAATGCTATTGGGGCAAAGAAACTCTTGATATGATAAATCCCGTGCAACAGCAGAATCAAATTGGATATCCCCAACCTTATGGCCAGTGGGGCCAGTGGTATGGAAATGCACAACAAATTGGCCAGTATATGCCTAATGGTTGGCAAGTTCCTGCATATGGAATGTATGGCCAGGCATGGAACCAGCAAGGATTTAATCAGACACAGTCTTCTGCACCATGGATGGGACCAAATTATGGAGTGCAACCGCCTCAAGGGCAAAATGGCAGCATGTTGCCCAATCAGCCTTCTGGGTATCGAGTGGCAGGGTATGAAACCCAGTGAATAAGGACTCCAGAATCTAAAGCCAGTGGCTTGAGGCTACAGGGAGTGTAGTAAAGCCGTTGTTTACTTAAAGATTTATCAAATCAGTCAGTGCAAATGTCAGATACAAT