Transcript asmbl_25065

Sequence
Transcript Sequence for observation asmbl_25065 of TGE0004418:
CGCTGGAGTAGGCCTAGGTAATGGCCTGGGGCGTCCACGCGGGGGCGGTCTCCGCGGTGGCCGGGCCTGGGGGCGCGGTAGGCCGAGAACTCCCCCAGGAGAGGTGGTGTGGGTGGAGCGCGCTCGGCGGCCACCGGACTCGGGGCCAGTTTGGGTGCCCCGCAGACCTCCGAGGGCTCAGAGCTGGGGCGGCGCCCCGGGTGGAGGCACAGGGCCGGCCTGGGGGATATCCCCAGAGGACCGGGGCTCCCCGGAGCCACCCAGCGGCGATGTGTGGGTGCCTCGGGGCCGGCCCCCTGCAGCGGCCTCAGAGGTGTGGGTGTGCTGGACTGGGGGAAACTGGGTGTGGCGTGAGTGGGATCGCCCGGTTGGGGCAACTGCTGTGCAGCCAGATAGGGTCTGGACTTTGCGTAAAGGGACGGATGGAAATTGAAGAACGGAGATGGGGACCAGGAGGGAGGGAAGGACTGGGGGTGAGCAAAGGGGCGGGGCCCTGGCTGCTGTGGCCTCCCCTGACCCCCTCCCCCCGCTGCTGGGGTCCTCGGGCAAGCCCCCTTCTCACTGGACTGAGACATGAGGCTGAACTGGGTCCTGACAATACTGTCCATCTGCCTGAGCGCCCTGGCCACGGCCGCAGGGGCCGAGGGCAAACGGAAGCTGCAGATCGGGGTCAAGAAGCGGGTAGACCACTGTCCCATCAAATCGCGCAAGGGGGACGTCCTGCACATGCACTACACGGGGAAGCTGGAAGATGGGACAGAATTTGACAGCAGCCTGCCCCAGAACCAGCCCTTTGTCTTCTCCCTGGGCACGGGCCAGGTCATCAAGGGTTGGGACCAGGGGCTGCTGGGGATGTGTGAAGGGGAAAAGCGGAAGCTGGTGATTCCATCAGAGTTGGGATATGGAGAGCGGGGAGCCCCGCCAAAGATTCCAGGTGGTGCAACCCTGGTGTTCGAGGTGGAACTGCTCAAAATCGAGCGACGTTCAGAACTGTAGCAAAGCTGGGGAGGGGCAGCGGAGAGGCCATCAGGGACCAGACTGTTTAAAAGAAAAACAAAAACAAACTTAAAGCTTA