Transcript asmbl_25046

Sequence
Transcript Sequence for observation asmbl_25046 of TGE0004413:
CTTAGTGCTCCAGCCCCCGCCTCCTGCAGCAGCCCGGTGGGGGGTGGGGAGGCGGGACCGGGTGGCGAGGTTGTGGTCTCAGGGCCGGGCGTGGAGCTGACATTATGTACGTCCTGGCCCACTGTGCCAGCTCGGTACCTGTCCGGGCAGTTGCCATCCATTGTGCGACAGCGGCGGCAGCCAGAGCGTACCTGGAAGGAGGTCTACAGTGGACGCTTGGCAAGGCCCGCGGTTTCAGAAGCGCCGCTGCAGCTATGGCCCCGATCAAGGTGGGAGATACCATCCCGTCTGTGGTGGTGTTCGAAGGGAAGCCTGAGAACAAAGTGAACTTGGCAGAGCTGTTCAAGGGCAAGAAGGGGGTGCTTTTTGGAGTCCCTGGGGCCTTTACCCCCGGTTGTTCCAAGACCCACCTGCCAGGGTTTGTGAATCAGTCTGGGGCTCTGAAGGCCAAGGGGGTCCAGGTGGTGGCATGTCTGAGTGTTAACGATGTCTTCGTGACTGAAGAGTGGGGACGAGCCCATAATGCAGAAGGCAAGGTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAGGAGACGGATTTGTTGCTAGATGATTCATTGGTGCCCCTCTTTGGGAATCGACGGCTCAAGAGGTTCTCCATGGTGATCGAAGATGGTGTAGTGAAGGCTCTGAACGTGGAGCCGGATGGCACAGGCCTCACCTGCAGCCTGGCCCCCAACATCCTCTCGCAGCTCTGAGGCCCTGGGCCCAGATACACTCCTACCCTTTTTTGTTTCACCTGCCCAGCTAAAGGCAGAGGGCCCCAGCCCAGCCTCAGCTAGGGCCACCCGATTGGAACTTTGGCTAGATTTCTTCAATAAACACTTTTGGTTCA