Transcript asmbl_25036

Sequence
Transcript Sequence for observation asmbl_25036 of TGE0004412:
CCGGGACTGAAAACGGCTGCCGGAGGGGGCTACGGGGATCATGGGCCTTTTGACCATCCTGAAGAAGATGAAGCAGAAAGAGCGGGAGCTGCGACTGCTCATGCTTGGCCTGGACAATGCTGGCAAAACAACCATCCTCAAGAAGTTCAATGGAGAGGACATCGACACCATCTCTCCAACGCTGGGCTTCAACATCAAGACCCTGGAGCACCGGGGATTCAAGCTGAACATATGGGATGTGGGCGGCCAGAAGTCCCTGCGCTCCTACTGGCGAAACTACTTTGAGAGCACGGATGGCCTCATCTGGGTGGTGGACAGCGCTGACCGCCAGCGCATGCAGGATTGCCAGCGCGAGCTCCAGAGCCTGTTGGTGGAGGAGCGCCTGGCCGGAGCCACCCTCCTCGTCTTTGCCAACAAGCAGGACCTTCCCGGAGCACTGTCCTCTAATGCCATCCGTGAGGCCCTGGAGCTGGACTCCATCCACAGCCACCACTGGTGCATCCAGGGCTGCAGCGCCGTCACTGGGGAGAACCTGCTGCCCGGCATTGACTGGCTCCTGGATGACATTTCCAGCCGCATCTTCACGGCCGACTGAGCCGCTCCAGACGCCCCGACATCACAGTCTGGGTCGTCCCTTCTACCCCCTGGCCCTCACCAAGCACCATCCGTGGGAGGATGGGAATCAGCCAGCCCAACTAACACTCCCCAACCCCTCCGTAACCTGCTGCCGCCGCCCGCTGCTGCTCCGTGGCCAGCCAGCTCCCATGACAGGAGGGCTGCCCTCCTGGCTGTCACCCTGGCTCCTGACCTGGCCCTGCAGCTGCCATACCAAGAGGTGAGGGTTGGGGCTGGGCGGGGGCTGTCTCTGCTGCTATGGAGGCTGTGGGCCTCGTCCTTTGCTCAGCTGTAAGAATAAACAGTTCC