Transcript asmbl_25018

Sequence
Transcript Sequence for observation asmbl_25018 of TGE0004407:
GTGATGATTGCATAACAATATGATTCATTTAATACCACTGACATGTTAAAGTGGCTAAGATGGTAAATTTTGTGTTATATATATTTTGACACAATAAAAGAATTGTAAGGAAAATGCCATAACCAAATCTCACTTTGATCAGTTCCTGCCACTTTCCTCTCGTTGCTCATGTGCACTGCTAGTGACGTGCCTGACACGTGTTCCAGTTGTTTGCGTACCTGCCTGTCTGCACCAGCTGACGGGATTCTCTGAAGATGGGGATGAGGTCTCCTCATCTTGGATTCCCAGAGTCGCACACAGAAGACTCTCAATCTGACCTCTGAGGCATTTTCCCTAACTGTCCTTTCTCCCACCATCCCAGTATCTTCTAATCAACGCCTTACGGTCCTTTCTATCTTAGACTTTGAGCAGAACATGGTCCTGGTGGCCTGTGGACCATACACCACGTCTGACAGCATCACATATGACCCCCTGCTCGACCTGATCACCATCATCAACCACGACCAGCCAGACATCTGCATCCTGTTTGGCCCTTTCCTGGATGCTAAGCATGAACAGGTTGAGAACTGTCTGCTGACGAGTTCGTTCGAAGATGTTTTCAAGCAGTGTCTACGAACAATTGTCGAAGGGACTCGAAGCTCCGGCTCCCACCTCGTCTTTGTCCCGTCGCTGAGAGATGTCCAGCACGAGCCCGTGTACCCACAGCCACCTTTCAGCTACTCCGACCTGCCTCATGAGGACAGGAAGCGAGTGCAGTTCGTGTCTGACCCCTGCAGCCTCTCCGTGAATGGTGTGGTCCTTGGCCTGACGTCCACGGATCTGCTGTTCCACATGGGGGCCGAGGAGATCAGCAGTTCTTCTGGAACTTCAGACAGATTCAGCCGAATACTGAAGCACATCCTGACCCAGAGGAGCTACTACCCGCTCTACCCTCCCCAGGAAGACATGGCCATTGACTACGAGAGTTTCTGCGCCTACGCACAGCTGCCCGTCACCCCGGATGTCTTCATAGTCCCGTCAGAGCTGAGGTACTTCGTGAAGGACGTCCTTGGCTGTGTCTGCGTGAATCCTGGACGCCTCACCAAAGGGCAGGTGGGGGGCACCTATGGCCGGCTCTACCTCAGGAGGCAGACCCCAGAGGCCGGGGAGGGGAGGCGGAGTCCATGTGTTGCTGCCCAGGTGGTCAGGATCTGAGCCTTCAGGCACTTTGTCCCCCACTGTGCGGGCCTGGAGGCCCTAGGACCCAGGACTATCTGACAAGATTCCGCCCCGTTGGAAGGTGAAGAAGAGGAGGCGGCCACAGCTGGGGCGTGGAGGCCGCGGGGGCGGGCCCAGCACAGAAGACATCATGCAGCCGTCTCGGACTTCGAGTGAGCTCCATTGGAAGAACGCCTTTGCTCCTGATACACGGATTATAACGTGAACTGCCTGTGGATGCAGCACACTTGGAAAAAGCGAGAAGGCTTTATGACCTTCTACACGAATAAGACAACTTTTGGAGAAATAAAAGTAAATTCTG