Transcript asmbl_13310

Sequence
Transcript Sequence for observation asmbl_13310 of TGE0000137:
TCCCGGGCTGGGGGTGGGGGTACGCCGCACAGCTCCAGTCGCCGTCGCGGCTTCCGGTGCTAGGTGGAGGGAAGGAAGGAGGGAGCCGGGGAGTGGGCCAGGGCAGCAGCCGGGCTGAAGTCGGCTTGGGGAGCCAGAGGGAGCGGAGCGGAACCTGCGGGGCAGAGGCGGCGGCCGCAGCGGCGCAGCTGATAGCAGGAACAGGATCAAGTCTTCCATACCAGGGACCAGGCCAAAACCAGACTGCCACTGCCCCTACTTGGGCCCCACTGTCCCCAGAAAGCAGCTGCTGTGATCATGGGCAATATCTTTGGAAACCTTCTCAAGAGCCTGATTGGGAAGAAGGAGATGCGCATCCTGATGGTGGGCCTGGATGCCGCAGGAAAGACCACCATCCTATACAAGCTGAAACTCGGGGAGATCGTCACCACCATCCCTACCATTGGGTTCAATGTGGAGACAGTGGAGTATAAGAACATCAGCTTTACAGTGTGGGATGTGGGTGGCCAGGACAAGATTCGACCCCTCTGGAGACACTACTTCCAGAACACCCAAGGGTTGATATTTGTGGTCGACAGCAATGATCGGGAGCGAGTAAATGAGGCCCGGGAAGAGCTGATGAGAATGCTGGCGGAGGACGAGCTCCGGGATGCTGTACTCCTTGTCTTTGCAAACAAACAGGATCTGCCTAATGCTATGAACGCTGCTGAGATCACAGACAAGCTGGGCCTGCATTCCCTTCGTCACCGTAACTGGTACATTCAGGCCACCTGTGCCACCAGCGGGGACGGGCTGTACGAAGGCCTGGACTGGCTGGCCAATCAGCTCAAAAACAAGAAGTGAAAGCCAGACAGCCCTAACAAAGCACCCCACCCACCCCTGACATACCTACTGTCACCCTGCCCCAGTCCTACCCCTTCCTCTCCATGCAAGTGTGGCCAGGGCCCTGGGTATCATGTCCACATGCCCAGCAAGAGCCTTGCCTCCCCTGCCTCCCCTCCTTTTTCCTGTCCACCTATATGACCAATCCCTAATTGCTGTCCTGATGATGAGTCATTCCAATTTACTGGATTTAAAACAAAAAGTTGTTACGGTTTCATGGGGTGGCCCCTCTCTCTCTCACCCTCTGGGTTTCGGGAGGTCGAGTGGGGTATTCTCTTTGTTTGGCAGTGGTTGCTGTCCTCTTGGCATCTGAGTCCTTTCCCTGTCCCCACAAGCCCTTCTACTCCCTGTTTGCCTTTCCTTTGCCACCCTCTCCCTGTTTTACATGGAAATTGCACGGGCCTCTCTGTGTTTGCGTGCATGTGTGCGCCTGTATATACATGTATAGAGAGATATATTTGTGGGGGCCGGGGGGAGCGGGGAG