Transcript asmbl_25014

Sequence
Transcript Sequence for observation asmbl_25014 of TGE0004408:
GGGATTTTCCCGGCGGCCGTGTTCTACTGGGGTCTTTGGGATGCTTAGCGTTGGAGGCTTCCCCCACATTGTTTTAAAAAGTGTTTCTCCGTGACTGACCGCTGGGGCTTTCTGACCGCCTGAGGTCTTGGGCTATTTGGTCACCTTCCTTCTCGGTCCCCCAGAGGGCAAAAGGACCAGAGTGACCTCCTGCTGATCGATCTCCACACCCGAGGGTTTCTTGGACTCAGGTCGGAGCTGTGTGGACCCGCCCCCACTCCTGTGTCACCATGTCCGTGTCCACCCAGCAGCTGGCCGAGGAGATGCAGATCTTCGGCCTAGAGTACGAGGAGCCTCTGATTGAGAAATTGGCGGAGCTGTGCGTTCTGCATGGAGAGAATGAGGCGGGAATGGTAGGCGAGCTCATAGCCTTCTGCACCAGCACGCAGAAAGATCGCCTCACCGCAGAGACCCTGAACTCTTTTGAGCATGAGGTTCTGAGCAAAAGATTGGCCAGATCCCGGCACAGTGCCTCCAAGGACAGTGGGCACGCGGGAGCTAGAGACATCATTTCCATACAAGAGCTAATCGAAGTGGAGGAGGAAGAGGAGACCCTTCTGAATGCCTATTCCACACCCTCCAAGGGTTCTCAGAAGCGAGCTGTCACCACCCCAGAAACCCCCCTAACCAAAAGGAGAGTGTCTGCTCGCAGCCCCCACCAGCTCCTCTCACCATCGAGTTTCTCTCCAAGTGCTACTCCCTCTCAGAAATACAACTCGAGGAATAACCGAGGAGAAGTGGTTACCTCCTTCGGCTCGGCCCAGGGAGTGTCTTGGTCCGGGAGAGGAGGAGCCGGCATCATCAGCCTAAAGGTCTTGGGGTGTCCAGAGTCACTAACCGGGAGCTACAAATCAATGTTTCAGAAGCTGCCAGACATTCGAGAAGTTCTGACCTGTAAGGTAGAAGAACTTGGCAGTGAACTCAAGGAACATTACCAGATCGAGGCTTTTGCTCCTGTTCTAGTTCCAGCACAAGAGCCCGTCACTCTGCTGGGCCAGATTGGCTGTGATAGCAACGGGAAGCTGAACAACAAGTCGGTGATTCTAGAGGGGGACCGGGAGCATTCTTCCGGCGCTCAAGTTCCAGTGGATTTATCTGAGCTCAGAGAATACTCTCTGTTTCCTGGACAGGTTGTAATTATGGAAGGAATGAACACGACTGGTAGAAAACTCGTTGCCACTAAACTCTATGAGGGTGTGCCACTTCCATTTTATCAGCCCACCGAAGAGGAGGGAGACTTTGAGCAGAACATGGTCCTGGTGGCCTGTGGACCATACACCACGTCTGACAGCATCACATATGACCCCCTGCTCGACCTGATCACCATCATCAACCACGACCAGCCAGACATCTGCATCCTGTTTGGCCCTTTCCTGGATGCTAAGCATGAACAGGTTGAGAACTGTCTGCTGACGAGTTCGTTCGAAGATGTTTTCAAGCAGTGTCTACGAACAATTGTCGAAGGGACTCGAAGGTCAGAGTTCAGAATGCTGGGCAGAACCTTAAGCTGCCCAGGTTTCTCCAGGGCCTCCCGTTAGAAAAACAAGCTACTCGAAAGTAGTGGTAGCTCCTATCCTTTCGTCCTTTTGAAGTAGAGATCAGATAGAGCTCTTGAACTTCAAGTGCCCAGACGCGGAGTTAAGAGGCATCTTGGTAAAACAAAGATAAACACACACTAGCCGCTCTCCTTCCCCTCTCCCTCCTTCCTTCCTTGTCTCACTCCTTCCGTATAGACCCACATTCCACAGGAATCTTCCCAGGATGCTTCTGAGAAGTGATTTTGTTGATGACTTACACAGCAGAATCCCAAGAGGCCCTAGACAGCTCGTTGTGGGAGTGATTGTTTTGGGGCGAGCCCAAGTCCTTCCCCTGAGTCACTGCTTCCCCACGTTTTGTGAGGCATCGCCAGTCGCCAAAGCGAGCTGTGGTAGAAACTCAGGGAGGGTGGGGATCTCGAATCTCTGCCACAGACCAAGGAGAAGGAACTGCGAAAGGTCACGGTGGTGATGAAAGATGTGTAGTTCTAATTTAAGAGAAAAGGCGCCATTCCAGGGAGAGTCGAAAACTACAAGCAGAAGGTTATTCAGGAAGTTGACATCCTCACTTCCTGACCCTTTTCCTCCAAGGTTTCCAAGAAATTAATATAGGTGATGGGTGTTCTCTGGGGATTTGCTTTCCTGTAGTAGAGCTCATAAAAAATATTCCTGAGGCTAAGCTTTTAAAAGCAAGTCTGGAACAAAGGTGGTTTTTTAAAACAAAATGTATGATCTTCCACTGCTTGGCTGTGAGAACTGATCCCAGAGTCAGGGGACTTGAATTGTGCCGGTGACAGCCTGCAGCTGGATCCACCCCTCCCTCCCTCCTTTGAGTGAAGATGACACAGGTACCTTCCCTCTCACCTCCCAGGTTTCACCCTGAACCAAGCACATCAGCCCCGGAGAGCTCAGGAGGTACACCCCGAAAAAGCAGGAGCAGGGCTGCTGTCCCTGTGCTGTCAGCCCTCAGATCTCCTCGGGGACAGGCGGGGGCTGTGTGGCAGTGCCCAGCACCGGCGGGCTGCTGTCAGTGTGAGATCGGGTTCTGGTTTGGTTCCTTGCTCCATGTGGTGTTGACAGCAGTGGTACAAAGAACAAAGCAGGCTTTGTTCCCCTGGGGGCAGCGCCCAGCACCACCAGGCACTTTCATCTGTGGCCAGTGTTTGCCCCGGGCTGGGGGGCTGCCCC