Transcript asmbl_31589

Sequence
Transcript Sequence for observation asmbl_31589 of TGE0001385:
ACCCCCGATCCCGCCAGCCACTCGCCCCTGGCCTCGCGGGCCGTGTCTCCGGCATCATGTGTGGTATATTTGCTTACTTAAACTACCATGTTCCTCGAACGAGACGAGAAATCCTGGAGACCCTAATCAAAGGCCTTCAGAGACTGGAGTACAGAGGATATGATTCTGCTGGTGTGGGATTTGATGGAGGCAATGATAAAGATTGGGAAGCCAATGCCTGCAAAATCCAGCTTATTAAGAAGAAAGGAAAAGTTAAGGCACTGGATGAAGAAGTTCACAAGCAACAAGATATGGATTTGGATATAGAATTTGATGTACACCTTGGAATAGCTCATACCCGTTGGGCAACACATGGAGAACCCAGTCCTGTCAATAGCCACCCCCAGCGCTCTGATAAAAATAATGAATTTATCGTTATTCACAATGGAATCATCACCAACTACAAAGACTTGAAAAAGTTTTTGGAAAGCAAAGGCTATGACTTCGAATCTGAAACAGACACAGAGACAATTGCCAAGCTCGTTAAGTATATGTATGACAATCGGGAAAGTCAAGATACCAGCTTTACTACCTTGGTGGAGAGAGTTATCCAACAATTGGAAGGTGCTTTTGCACTTGTGTTTAAAAGTGTTCATTTTCCCGGGCAAGCAGTTGGCACAAGGCGAGGTAGCCCTCTGTTGATTGGTGTACGGAGTGAACATAAACTTTCTACTGATCACATTCCTATACTCTACAGAACAGGCAAAGACAAGAAAGGAAGCTGCAATCTCTCTCGTGTGGACAGCACAACCTGCCTTTTCCCGGTGGAAGAAAAAGCAGTGGAGTATTACTTTGCTTCTGATGCAAGTGCTGTCATAGAACACACCAATCGCGTCATCTTTCTGGAAGATGATGATGTTGCAGCAGTAGTGGATGGACGTCTTTCTATCCATCGAATTAAACGAACTGCAGGAGATCACCCCGGACGAGCTGTGCAAACACTCCAGATGGAACTCCAGCAGATCATGAAGGGCAACTTCAGTTCATTTATGCAGAAGGAAATATTTGAGCAGCCAGAGTCTGTCGTGAACACAATGAGAGGAAGAGTCAACTTTGATGACTATACTGTGAATTTGGGTGGTTTGAAGGATCACATAAAGGAGATCCAGAGATGCCGGCGTTTGATTCTTATTGCTTGTGGAACAAGTTACCATGCTGGTGTAGCAACACGTCAAGTTCTTGAGGAGCTGACTGAGTTGCCTGTGATGGTGGAACTAGCAAGTGACTTCCTGGACAGAAACACACCAGTCTTTCGAGATGATGTTTGCTTTTTCCTTAGTCAATCAGGTGAGACAGCAGATACTTTGATGGGTCTTCGTTACTGTAAGGAGAGAGGAGCTTTAACTGTGGGGATCACAAACACAGTTGGCAGTTCCATATCACGGGAGACAGATTGTGGAGTTCATATTAATGCTGGTCCTGAGATTGGTGTGGCCAGTACAAAGGCTTATACCAGCCAGTTTGTATCCCTTGTGATGTTTGCCCTTATGATGTGTGATGATCGGATCTCCATGCAAGAAAGACGCAAAGAGATCATGCTTGGATTGAAACGGCTGCCTGATTTGATTAAGGAAGTACTGAGCATGGATGACGAAATTCAGAAACTAGCAACAGAACTTTATCATCAGAAGTCAGTTCTGATAATGGGACGAGGCTATCATTATGCTACTTGTCTTGAAGGGGCACTGAAAATCAAAGAAATTACTTATATGCACTCTGAAGGCATCCTTGCTGGTGAATTGAAACATGGCCCTCTGGCTTTGGTGGATAAATTGATGCCTGTGATCATGATCATCATGAGAGATCACACTTATGCCAAGTGTCAGAATGCTCTTCAGCAAGTGGTTGCTCGGCAGGGGCGGCCTGTGGTAATTTGTGATAAGGAGGATACTGAGACCATTAAGAACACAAAAAGAACGATCAAGGTGCCCCACTCAGTGGACTGCTTGCAGGGCATTCTCAGCGTGATCCCTTTACAGTTGCTGGCTTTCCACCTTGCTGTGCTGAGAGGCTATGATGTTGATTTCCCACGGAATCTTGCCAAATCTGTGACTGTAGAGTGAGGAATATCTATACAAAATGTACGAAACTGTATGATTAAGCAACACAAGACACCTTTTGTATTTAAAACCTTGATTTAAAATATCACCCCTTGAAGCCTTTTTTTAGTAAATCCTTATTTATATATCAGTTATAATTATTCCACTCAATATGTGATTTTTGTGAAGTTACCTCTTACATTTTCCCAGTAATTTGTG