Transcript asmbl_24869

Sequence
Transcript Sequence for observation asmbl_24869 of TGE0004390:
AGGAATGGGACAAGATGACACAGTGCCACTGAGGTCAAGGGTCAGGGCTCCTGCAGTGTCAGAGTCCTGGGGGGCCGGGTCTGGGACCCACCGCACCTCCCGTGCTTTTCATGCTGACAGATGCGCTGCCTGACTACACCCACGCTGCTTCGGGCCCTGGTCCAGGCCGCACACACAGGGCATTCTAGTGGCCGGAGCCTGCACAGCGGCGCAGTGGCAGCCACCTATAAGTACGTGAACGCGCAAGAGCCCTCCATGGACATGAAGTCGGTGACTGACCGGGCAGCTCAGACCCTGCTGTGGACGGAGCTCATCCGAGGCCTGGGCATGACCCTGAGCTACCTGTTCCGGGAGCCAGCCACCATCAACTACCCGTTTGAGAAGGGCCCGCTGAGCCCGCGTTTCCGCGGGGAGCACGCGCTGCGCCGTTACCCATCCGGGGAGGAGCGCTGTATCGCCTGCAAGCTTTGCGAGGCCGTCTGCCCCGCCCAGGCCATCACCATCGAAGCCGAGCCTCGGGCTGACGGCAGCCGCCGGACCACCCGCTACGACATCGACATGACCAAGTGCATCTACTGTGGCTTCTGCCAGGAGGCCTGCCCCGTGGACGCCATCGTCGAGGGCCCTAACTTCGAGTTCTCCACGGAGACGCATGAGGAGCTGCTGTACAACAAGGAGAAGCTGCTGAACAATGGGGACAAGTGGGAGGCTGAGATCGCTGCCAACATCCAGGCCGACTACCTCTACCGGTGACACTCCTGCCCGGCTGGCCCGCAGCCCCTGCTGCCCAATAAAGAAGCTCTGCTCTCCCCCACTG