Transcript asmbl_24802

Sequence
Transcript Sequence for observation asmbl_24802 of TGE0004379:
TGTTTCCATCGCCCCGTCTTAGCGTAGGGGCCACACACCCCTCTGTCCCGCTTTGTCTTCCACGAGGGGGATGACGACAGGACTGGCCCAGGTCGTGGAGAACTCCGCCTGACGTGGTCGATAAAGGTCACCCAGGGCTGCGGCCCTGCCCCGAGGCCACCTTCGTCTCCACGGGCCATGCAGGAATTCAGTTGGTGAGAACTCGGATAGGTGACCGGTACACTCGCCATTCTGTTGAGGACCAAGTCGGCTCGGGGGCCAGACTGGTGTCAGAGACGGACACTCGGGGCACGTCAGTCGGCATTTCTCAAATTGCACGTCACTGAGTAGCGAGACCGATTTGACTGGTAGAAACCAGTGTCTTGAAAATGAAGGAGAAATGATCAACATGTGTCACATCAGGAGAGACCTGGTCAACTGCTGTCACTGCACACATGGCACGTGTGCACACACGAAGCGCACACGTGTACTGGGCTGTGGTACACTTCCTTACTGTGGATCTTGATGGAAAACACTGGAAAGTCACCGCTGTTCACTGCACTTTGGTCACACCACTGAAACGATCCTCCCCAGAGCTGGGACCCTCGAATGGTGCAAGCAGCAGGGTGCAAGCAGCAGGGTGCAAGCTCTGGGTGCAAGCAGCAGGTCCAGAGCCCTCTGGGCAACCAAAGGCCCCCTGAATCCCAAGGTTGGACCCTGCTGTGACATGCCCGCCATGAAGGCGCTCCTCAGCACACTCTGGCTTGCTCTGGCCTGTGGCTCTGTGCACACCACCCTGTCAAAGTCAGATGCCAAAAAGGCCGCCTCCAAGACACTGCTGGAGAAGACTCAGCCTTCAGAGAAGCCTGTCCAAGATCGGGGTCTGGTGGTGACGGACCCCAGACCCGAGGATGTGGTTCTCGAGCATCGTAGCTACTGCTCCGCAAAGGCACGGGAAAGGCACTTTGCTGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCACGGCTACGACGTCGCCAAGGTGTTCGGAGGCAAGTTCACACAGATCTCGCCCGTGTGGCTGCAGCTGAAGCGGCGCGGCCGTGAGATGTTCGAGGTCACAGGCCTCCACGACGTGGACCAAGGGTGGATGCGGGCGGTCAGGAAGCAGGGCAGGGGCCTGCGCATAGTGCCTCGGCTCCTGTTTGAGGACTGGACCCGCGAGGATTTCCGGCGTGTGTGGGACAGTGAGGACGAGATAGAAGAGCTCAGCAAGGCCGTGGTCCAGGTTGCCAGGGACCAGCACTTTGATGGCTTCGTGGTGGAGGTCTGGAGCCAGCTGCTCAGCCAGAAGCACATGGGCCTCATCCACATGCTCACTCACATGGCCGAGGCGCTGCACCAGGCCCGGCTGCTGGCCATCCTCGTCATCCCACCGGCTGTCACCCCCGGGACTGAGCAGCTCGGCGTGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCCGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACCCCGCAGTGCAGCAGCCTGGCCCCAATGCACCGCTGTCCTGGGTGCGAGCCTGTGTCCAGGTCCTGGACCCCAAGGCCAAGTGGCGGAGCAAGATCCTGCTGGGGCTCAACTTCTACGGCACAGACTACTCGACCTCCAGGGATGCCCGCGAGTCCGTCGTTGGGGCCAGGTACATTCAGACGCTGAAGGAGCACAGGCCCCGGATGGTGTGGGACAGCCAGGCAGCAGAGCACTTCTTCGAATATAAGAAAAGCCGCCGGGGAAGACATGTCATGTTCTACCCGACTCTGAAGTCCCTGCAGGTGCGGCTGGAGCTGGCCCGGGAGCTGGGCGTCGGGCTGTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTGTAGGCCCGCCGCGGCCCAGTGCTCTTCTCAG