Transcript asmbl_24800

Sequence
Transcript Sequence for observation asmbl_24800 of TGE0004379:
CGCGAGCGTCTTCCGGCTGCGCGCGAGAATTGTCCGGCCGGCATCCGGGACATGAAGCCCCCTGAATCCCAAGGTTGGACCCTGCTGTGACATGCCCGCCATGAAGGCGCTCCTCAGCACACTCTGGCTTGCTCTGGCCTGTGGCTCTGTGCACACCACCCTGTCAAAGTCAGATGCCAAAAAGGCCGCCTCCAAGACACTGCTGGAGAAGACTCAGCCTTCAGAGAAGCCTGTCCAAGATCGGGGTCTGGTGGTGACGGACCCCAGACCCGAGGATGTGGTTCTCGAGCATCGTAGCTACTGCTCCGCAAAGGCACGGGAAAGGCACTTTGCTGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCACGGCTACGACGTCGCCAAGGTGTTCGGAGGCAAGTTCACACAGATCTCGCCCGTGTGGCTGCAGCTGAAGCGGCGCGGCCGTGAGATGTTCGAGGTCACAGGCCTCCACGACGTGGACCAAGGGTGGATGCGGGCGGTCAGGAAGCAGGGCAGGGGCCTGCGCATAGTGCCTCGGCTCCTGTTTGAGGACTGGACCCGCGAGGATTTCCGGCGTGTGTGGGACAGTGAGGACGAGATAGAAGAGCTCAGCAAGGCCGTGGTCCAGGTTGCCAGGGACCAGCACTTTGATGGCTTCGTGGTGGAGGTCTGGAGCCAGCTGCTCAGCCAGAAGCACATGGGCCTCATCCACATGCTCACTCACATGGCCGAGGCGCTGCACCAGGCCCGGCTGCTGGCCATCCTCGTCATCCCACCGGCTGTCACCCCCGGGACTGAGCAGCTCGGCGTGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCCGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACCCCGCAGTGCAGCAGCCTGGCCCCAATGCACCGCTGTCCTGGGTGCGAGCCTGTGTCCAGGTCCTGGACCCCAAGGCCAAGTGGCGGAGCAAGATCCTGCTGGGGCTCAACTTCTACGGCACAGACTACTCGACCTCCAGGGATGCCCGCGAGTCCGTCGTTGGGGCCAGGTACATTCAGACGCTGAAGGAGCACAGGCCCCGGATGGTGTGGGACAGCCAGGCAGCAGAGCACTTCTTCGAATATAAGAAAAGCCGCCGGGGAAGACATGTCATGTTCTACCCGACTCTGAAGTCCCTGCAGGTGCGGCTGGAGCTGGCCCGGGAGCTGGGCGTCGGGCTGTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTGTAGGCCCGCCGCGGCCCAGTGCTCTTCTCAG