Transcript asmbl_24532

Sequence
Transcript Sequence for observation asmbl_24532 of TGE0004335:
GACATGTCCTTCCGAAAAGTGGTTCGGCAGAGCAAATTCCGGCATGTGTTTGGGCAGCCGGTCAAGAATGACCAGTGTTATGAGGACATCCGAGTGTCCCGTGTCACCTGGGACAGCACCTTCTGCGCTGTCAACCCCAAGTTCCTGGCAGTGATTGTGGAGGCCAGTGGTGGAGGCGCCTTCCTGGTGCTCCCTCTAAACAAGACGGGCCGCATTGACAAGGCCTACCCAACGGTGTGTGGGCACACGGGACCTGTCCTGGACATCGACTGGTGTCCCCACAACGACGAAGTCATCGCCAGCGGCTCGGAGGACTGCACAGTCATGGTGTGGCAGATCCCAGAGAATGGGCTGGCCTCCCCGCTGACAGAGCCCGTGGTGGTGCTGGAGGGGCACACCAAGCGAGTGGGCATCGTCACCTGGCACCCGACGGCCCGCAATGTGCTGCTCAGCGCAGGCTGTGACAATGTGGTGCTCATCTGGAACGTGGGCACGGCGGAGGAGCTGTACCGCTTGGACAGCCTGCACCCCGACCTCATCTACAATGTCAGCTGGAACCGCAACGGCAGCCTCTTCTGCTCCGCCTGCAAGGACAAGAGCGTGCGCATCATCGACCCCCGCCGGGGCATCCTGGTGGCGGAGCGAGAGAAGGCTCACGAGGGCGCCCGGCCCATGCGGGCCATCTTCCTGGCGGATGGCAAGGTGTTCACCACCGGCTTCAGCCGCATGAGCGAGCGGCAGCTGGCGCTCTGGGACCCAGAGAACCTCGAGGAACCAATGGCCCTGCAGGAGCTGGACTCTAGCAACGGGGCTCTGCTGCCCTTTTACGACCCTGACACCAGCGTGGTCTACGTCTGTGGCAAGGGCGATTCCAGCATCCGGTACTTTGAGATCACAGATGAGCCCCCCTACATCCACTTCCTGAACACGTTCACCAGCAAGGAGCCCCAGAGGGGCATGGGCAGCATGCCCAAGAGGGGCCTGGAGGTCAGCAAGTGCGAGATCGCCCGATTCTACAAACTGCACGAGCGCAAGTGCGAGCCTATTGTCATGACTGTGCCAAGAAAGTCGGACCTCTTCCAGGATGACCTGTACCCTGATACGGCCGGGCCCGAGGCGGCCCTGGAGGCAGAGGAGTGGGTGAGCGGGCGGGACGCCGACCCCATCCTCATCTCCCTGCGGGAGGCCTACGTGCCCAGCAAACAGCGGGACCTGAAGGTCAGCCGGCGGAACGTGTTGTCTGACAGCCGGCCTGCTGTGGCCCCGGGCTCCGCGCGCCTGGCGGCCTCCACACCTGCCACCTCCACCCATACGACTGCCCCCAGCAGCAGCCTCGCTGGGGCCGGGGAGGCTGGGAAACTGGAGGAGGTGATGCGGGAGCTGCGGGCACTGAGAGCGCTGGTCAAGGAGCAAGGGGAGCGCATCGGCCGCCTGGAGGAGCAGCTGGGCCGCATGGAGAATGGGGACGCCTAGGACCATAGGCCCAGTGGATGCCACGCCCCCTCACCTCCTCCTCCTCCACCCACTTCTCACTCAGCCTCTGCTGGCAGGCCACACCGATAGCTGGCTGCCCCCTGCCCCCTGCCCCCTGCCGAGGGCCTCTGGGGCAGGCTCGGGGCCAGCCCACACCCTGATCCATCCTGTGGGCCAGGCTGGAGCCACCGCCTGGCTTTTGTCTTTGTTACTGTGGAGGATTTTTGTACCAAGGCGAGCTTATGTGAGGGACCCTCTCTCCACACGCCCACCCGCCCCCTGCTCCCTCCCGGAGGAGTGGGAGGGATGGGCTCTATATTTTCATTCCAAATAAAATTCACTTTCTAAAA