Transcript asmbl_24420

Sequence
Transcript Sequence for observation asmbl_24420 of TGE0000661:
TCTCACAGTGGAACGATGGGGTGCCTGTTGACAATGACGGTAAAGCCGTGTCCTGTCTTCCCCAACAGCCATAATGGTGCGCATGAACGTCCTGGCCGACGCACTCAAGAGCATCAACAATGCTGAAAAGAGAGGCAAACGCCAGGTTCTCATTAGGCCGTGCTCCAAAGTCATCGTCCGGTTTCTGACTGTGATGATGAAGCATGGTTACATTGGCGAATTTGAAATCATCGATGATCACAGAGCTGGGAAAATTGTTGTGAACCTCACAGGCAGGTTAAACAAGTGTGGAGTGATCAGCCCCAGATTCGACGTGCAACTCAAAGATCTAGAAAAATGGCAGAACAACTTGCTCCCGTCCCGTCAGTTTGGTTTCATTGTACTGACAACTTCAGCGGGCATCATGGACCATGAAGAAGCAAGACGAAAACACACAGGAGGGAAAATCCTGGGATTCTTTTTCTAGGGATGTAATACATTTGTTCAAATAAAATGCCTCAATGGACTCTGGTGCTTCGCTCGGTCGTTTTGAACTTGACAGCAGAGTAGCGAGAGCGTCTGCGGCAGTGCAGCCTTTGCGTTAATTGGCGAAAGCCGTGTCCCTGAAGTGAACAAGAAAGTCTTGACTTGTGATAACTGAAGCCATCGTGCTCATGGCTCCCAGAGGAGAGTGTCGCCCAGGACGGTCGAATCT