Transcript asmbl_23783

Sequence
Transcript Sequence for observation asmbl_23783 of TGE0004287:
TTTTTTCCTTTTCAACCTTTGTTGTAACGCACTGAGACTGCAAGACTATAGTTCATTTAAAATTCCCAAGGGTGGTGGTTTCTACCAATATGAATCTTTTCAACCTGGACCGTTTTCGCTTTGAAAAGAGGAGTAAGATTGAGGAAGCGCCCGAAGCAACCCCTCAACCCTCCCTGCCTGGCCCTTCTTCACCAATTTCTCTTAGTGCTGAAGAGGAGAATGCTGAAGGGGAAGTTAGCAGGGCAGGCACCCCTGATTCAGATATAACTGAAAAAACAGAAGATTCTAGTGTTCCAGAAGCTCCAGTAAATGAAAGAAAAGCGAGTATATCATATTTCAAGAATGAGGGAGGAATACAGTATATTGATTTGTCTTCTGACAGTGAAGATGTTGTTTCCCCAAACTGTTCCAATACAGTTCAAGAGACAAAATTCAACAAAGACACAGTGATTATAGTTTCTGAGCCATCCGAAGATGAAGAGTCCGAAGGCCTTCCTGCCATGGCAGGTAGAAATAATGACGATATTTCAGAATTGGAAGACCTTTCGGAATTAGAAGATCTTAAAGATGCTAAACTTCAGACCTTGAAGGAACTTTTCCCACAAAGAAGTGACAGTGATTTACTTAAGTTGATTGAATCAACCAGCACGATGGATGGGGCAATTGCTGCTGCGTTGCTGATGTTTGGTGATGCAGAAGGTGGCGGACCCAGGAAAAGAAAATTATCTTCTTCTTCAGAGCCATATGAGGAAGATGAATTTAATGATGATCAGTCCATAAAAAAGAAAAGACTAGATCATGGAGAGGAATCAAATGAGTCTGCCGAATCTAGCAATAATTGGGAAAAGCAGGAAAGTATTGTATTGAAATTACAAAAGGAATTTCCCAATTTTGATAAACAGGAACTAAGGGATGTACTCAAGGAACATGAATGGATGTACTCAGAAGCTTTAGAATCTTTAAAGGTATTTGCAGAAGACCAAGATATGCAATATGCTTCACAAAGTGAGTTTCCAAATGGAAAAGAAGTTTCTTCAAGGAGTCAAAATTATCCTAAAAGTGTAACTAAAACAAAATTAAAACAGAAATGTGCCATGAAACCACAAAATGGTTTTAACAAGAAACGTAAAAAAAATGTATTTAATCCTAAGAGAGTCATTGAAGACTCTGAATATGATTCAGGTTCTGATGTCGGTAGTTCGCTAGATGAGGACTATAGTAGTGGCGAGGAAGTGATGGAGGATGGCTATAAAGGTAAAATTCTTCACTTCCTTCAAGACGCTTCAGTTGCTGAACTTACTTTGATTCCTCAGTGTTCTCAGAAAAAGGCTCAGAAGATAACAGAACTCCGGCCCTTTAATAGTTGGGAAGCTCTGTTCACAAAGATGTCCAAAACTAATGGCTTGTCAGAAGATTTGATATGGCACTGTAAAACACTGATCCAAGAAAGGGATGTAGTTATAAGGCTTATGAACAAATGTGAAGACATTTCTAATAAATTGACAAAACAAGTTACCATGCTCACTGGAAATGGAGGTGGATGGAACATAGACCAACCCTCCATTCTGAACCAAAGTTTATCACTCAAGCCCTATCAGAAGGTTGGTTTGAATTGGTTGGCATTGGTACATAAACATGGACTTAATGGCATTTTGGCAGATGAAATGGGCCTAGGAAAAACTATTCAAGCCATTGCATTCCTGGCATACCTGTATCAGGAGAGTAATAAAGGTCCTCATTTGATTGTTGTTCCAGCATCAACTATAGATAACTGGTTAAGGGAAGTTAATTTATGGTGCCCCACTTTAAAGGTGCTCTGTTACTATGGTTCTCAAGAAGAACGTAAACAGATAAGATATAACATTCATAGTAAATATGAAGAATACAATGTAATTGTGACCACGTATAATTGTGCAATCAGCAGTTCTGATGATCGCAGTCTCTTTCGGCGACTAAAACTTAATTACGCAATTTTCGATGAGGGCCATATGCTGAAGAATATGGGCTCCATTCGCTACCAGCACCTTATGACAATTAATGCAAATAACCGTTTGCTGCTCACAGGCACACCTGTACAGAATAATCTGTTAGAACTCATGTCACTGTTGAATTTTGTTATGCCACACATGTTTAGTAGTAGCACCAGTGAAATACGAAGAATGTTTTCTTCTAAGACAAAATCAGCAGATGAGCAAAGTATATATGAAAAGGAGAGAATAGCACACGCAAAACAAATTATAAAACCATTTATTCTCAGAAGAGTAAAAGATGAGGTTCTCAAGCAGCTGCCCCCTAAGAAAGATCAAATTGAGTTGTGTACAATGTCAGAGGAACAGGAACAACTCTATTTGGGTCTTTTCAACAGATTGAAAAAATCTATCAATAACTTGGAAAAAAACACAGAAATGTGCAATGTCATGATGCAATTGAGAAAAATGGCCAATCATCCTTTATTACATCGCCAATATTACACAGCTGAAAAACTCAAGGAAATGTCTCAGCTTATGCTAAAGGAACCTACACATTGTGAAGCTAACCCTGACCTGATCTTTGAAGATATGGAGGTTATGACAGACTTTGAATTACATGTACTTTGTAAACAATATCGACACATTAATAACTTCCAGTTAGACATGGACTTGATTTTAGATTCTGGAAAATTCCGAGCTTTAGGACGCATCTTGTCTGAATTGAAACAGAAGGGTGATAGAGTTGTGTTATTTAGCCAGTTTACCATGATGCTGGATATTTTAGAGGTTCTCTTAAAACATCATCAGCATAGGTACCTCAGATTAGATGGAAAAACTCAGATTTCTGAAAGGATTCATCTAATTGATGAGTTTAATACCGATATGGATATCTTTGTGTTCCTGCTGTCAACGAAAGCTGGTGGCTTAGGAATAAACCTGACTTCAGCGAATGTTGTTATACTTCACGATATTGACTGTAATCCTTACAATGACAAACAAGCAGAGGATAGATGCCATAGAGTAGGCCAGACTAAAGAAGTATTAGTTATAAAATTAATAAGCCAAGGGACAATTGAAGAATCCATGCTAAAAATTAACCAACAGAAATTGAAACTAGAACAAGATATGACCACAGTAGATGAAGGTGATGAAGGAAGCATGCCCGCAGATATAGCCACGTTACTAAAAACGTCAATGGGCCTGTGAAGTAAGACTTGTGAATTCCTGATTGATGAGGAAATATCAACTTGGTGCACTCAAGGAC