Transcript asmbl_23076

Sequence
Transcript Sequence for observation asmbl_23076 of TGE0011973:
GAAGCAGAAGAAAGAGAAAGAATGAAAGCTGAGCAAGACCAAAAGATAGCGGAGGAGAAAGCACGACTTGAAGCTGAAGAAAAAGCAGCAGAGAGAGAGAGAGAAAGACAAGAGAGAGAAAGAAGGGAGGCGGAAGAGAGAGAAAGGGCGAAGGAGAGAGAGAGAAGAGCCGCAGAGGAGAGGCGGGCAAAGGCGGAGGAGGAAGAGAAAGATCAGCTAGAAGAGCAAAAACGGGCAAAGCAGCTAGAAGAGAAGAGTGAGGTGCCCGAGAAAAAGATAAAAGGGGAAGAGGTAGAAGGAAAAATAGAAAGGAAATGGGTCCATGAAAAGAAAGGACAAGAAGATAAACGTCAGACAGCTGTCCAGAAAAAACAGATCAAAGATGAGAAGATGAAAAAGGACAAAGAGCCCAGGGAAGATGTTAAGAGCTTCTTGGATGGAAAGAAGGGATTCACAGAAGTCAAGTCGCAGAATGGAGAATTCGTGACCCACAAACTTAAACACACTGAGAATACTTTCAGCCGTCCCGGAGGGAGGGCTGGCGAGGCCAAGGAGGCGGAGGGCGCGTCCCAAGTGGAAGCGGGCAAGCGCCTGGAGGAGCTGAGGCGCCGCCGTGGGGAAACCGAGAGCGAAGAGTTCGAGAAGCTCAAACAGAAGCAGCAGGAGGCAGCCCTGGAGCTCGAGGAGCTGAAGAAAAAGCGGGAGGAGCGAAGGAAGGTTCTGGAGGAGGAGGAGCAGAGGAGGAAGCAGGAGGAAGCCGATCGAAAAGTCAGAGAGGAGGAAGAGAAGAGGAGGCTAAAGGAAGAGATTGAAAGGCGAAGGGCAGAAGCTGCTGAGAAACGCCAGAAGATGCCAGAGGATGGGTTAGCAGATGACAAGAAGCCATTCAAATGTTTCACTCCTAAAGGTTCATCTCTCAAGATAGAAGAGCGAGCAGAATTTTTGAACAAGTCTGTGCAGAAAAGTGGTGTCAAATCAACTCATCAGGCAGCAGTTGTCTCCAAGATTGACAGCAGACTGGAGCAATACACCAGCGCCATCGAGGGAACGAAAACCGCAAAACCTACAAAGCCAGCAGCCTCGGATCTTCCGGTTCCTGCCGAAGGTGTTCGCAACATGAAGAGCATGTGGGAGAAAGGGAATGTGTTCTCATCCCCCGCTGCGTCGGGCACGCCAAACAAGGAAACTGCTGGCTTGAAGGTGGGGGTTTCCAGCCGCATCAATGAATGGCTAACCAAAACCCCAGATGGAAACAAGTCACCTGCTCCCAAACCTTCAGATTTGAGGCCAGGAGACGTATCTGGCAAGCGGAACCTCTGGGAAAAGCAATCTGTGGATAAGGTCACATCCCCCACTAAGGTCTGAGACAGTTGAAGAAAGAACCCCAGAGTAGCCACTCAAGATGCTGGACCAGCTCAGCTGAAGAGGGTTAATGTGCTCTGTTTTATATTTATGTTGATTTACTAAATTGGGTTCATTTCCTTTTGTTTTATTTTCCATTATCCCGGTAAACCTATGTATATTATCACCATATTTAATAATCACAGTCTAGAGATGTTCATGGTAAAAGTACTGCCTTTGCACAGGAGCCTGTTTCTAACGAAACCCATGCTGTGAAATAGAGACTTTTCTACTGATCATCAGAACTGTGTGTGAACAGTGATACCAACCACATTGGAAGTCAAACAAAAGGAGATTCAAGTTGAAAATTGCCTGAGGAATGTGTGCAGTATCCAGAAAAATGAACCGTAGTGGGTTTTGGGTTTTTTTTTTAATTTTAAATACAAAAGTCATGTTGTTTCTGCACTTTAAAGCATGGAAGAAATTATCTTAGTAGGCAATTGTAACACTTTCTGAAACTAATTCATTTCAGATTTGAGATACTATAATGATGATTGTCTTTTTAAAAAAAATGTATTGTTAAGGTATTACTTTTTTCATGCTGATGAATATCTAAATCGGATAAGGATTTTAGCTGACAGGGGTACTGATTTATTTAGGTTGGTTGCTTTGTGGATTTCTTTGGTAGTGATAGTGAACCACATTTTAGATGACCTGATCATATATGTATGTGCATACACATATACAAACACACTAATGGTAGAAAGCTTTTTCATGTGCTAGACTATTGTATTTAGCAGTATGTCCTTGTAACTAGACAATATCACAGCTTTTTAAAAATTACAAATCACAATATTCTATTAATATTTCATATTTGCCAATGGAGACATGGCAGAATAGGTATCGATATGTTTTCGATGCCCGATAGATGACCTATAAGGAAAAAGAGAGATTAGAAATATCAAAATGTCAGTTTATAGAATCAACATTTTCTATGAAACATAATATTTAGCTTATAATTAAAGGCAATCTTGAAGGCCAATGTGAATTTTACTAAATCTACCATCTGGATCAAACTCAAAGCTTGCCCAAAACTTTATTCTGTTAATAAGCGAGTTCACAATAGGTTGGCCTAAATGATACCTGAGGTCTCTTCCTTTTTTCAAATTTAAAGACAAGAATTTTAGTGACAAGATTGTGCAGACTGAAATTCCATGGACAGGTATACAAAGACCAACTTTGGCTAATGTCTAGAAGCAGGGAAGAAAAGTAAGCAAAACCCACTGTTTAGAAGTCATGACAATACTTCCATCTTTAATATACTGAACCAATTTTTAAATTAAACTTTTCTACTTATATTATTAGTCATTGGTACTTATCATAAGTTGATAATGTGTCGAACTTTGAAGAAGTATATATAACTTTTATTAGTTTTATCTTTTTCCCCAAGAGTCTTCACCAACTCATCATTTTTACACAATCCAGATATCAGATCTTATTTTAGCTTATACGTGTCCATCTGTTCTTCCCAATAGATGATAAGAGTACTCCAGTGTCTTGGAAATATGTTCTAGCATAGAGATATATAGGGTAGTTCTATAAACTTATACCTCATTTGACTTAACCAAAATGGTCCTAGTCTCAATTCCTACCACAATGAGGGAACCTCCCAAATGACTCTTTTCTAGCTCTTTTTTGGAAGAGCTAGCCAGGGCAGTGCTGGCATGAAGAGTGACCACTGCCTGACAAAGTCTATCTTCCTCAAAAATTAGTAAAGAGTAATTGAATTCTCTAGCTTTTAGCGCACCTGGGACAAAGCAAGGAAAGCCGCCTAGACTGCACAAATCATCTGCCCAAGACAGAGTAGATATGAGTCTGTGATAAGATGAACTATAATCCACAAGTAGTGCCTGATTTAGCATTGACTCCCATCATTGGGATGAAACAGATCAAAGTTTGAATTAAGGCCCATGGCGATGTAACATTGCTTTGTTGTACTTTTGAACAAGAGCTTCGCCTGATCACTATTATATATGTTTTTCTAGAAAATCTAAAGTTGAGAAGAGAATATGTCGATCCTGACTTTTATTCCAATATTTGGATGGAATAAATTTTAGGGTAGAATTTTGTTTAGTTTGGATTTAATCTTTTGAAAAACAAATTCTTTGTTTACCTGTTTGATTACAACGCTCTTTGTTATCTTTAAGAGGTAAAGCTGCAAAGTGACTAGCATGTTCTGTGAATCTGCCATTCCTAAAAATTTTATAAACACTTGATATTTGTCACTGATAATTGATCGCTGCAATAAATATGTATTGTGAAAAAGCATCCACAATAAATGGAATTCCTCCAAA