Transcript asmbl_23010

Sequence
Transcript Sequence for observation asmbl_23010 of TGE0011959:
AAAGAAACACTTTGTGTCATCCAGGTCTTCTCACCTACCATCTTTTCACCATCTGTCACCAGGTTTCAAGATGCTGCGAGTACGTAGGACCGAGCTGTGCAGGTTGGGGCTCGGCCTCTCCAGGGGGCTTCACCAACAGCCTGTGATGGCCCTGAGGCGGGAGGACGTGAACGCCTGGGAGAGGAGGGCCCCTCTGGCCCCCAGGCACATCAAGGGGATCACCAACCTGGGATACAAGGTCTTAATACAGCCTTCCAATCGGCGGGCCATTCATGATAAGGAATATGTCAAAGCTGGTGGCATTCTTCAGGAGGATATTTCTGAAGCCTGTCTAATTTTGGGAGTTAAAAGACCCCCAGAGGATAAATTAATGTCCAAGAAGACTTATGCATTCTTCTCCCACACAATAAAGGCCCAGGAGGCCAATATGGGCTTATTGGATGAGATTCTAAGACAGGAAATCCGACTTATTGATTATGAAAAAATGGTGGATCATAGAGGAATTCGGGTAGTGGCGTTTGGACAGTGGGCTGGTGTGGCAGGGATGATCAACATTTTACATGGAATGGGTTTAAGGCTCCTTGCTTTGGGACATCATACACCTTTTATGCACATTGGCATGGCTCATAACTATAGGAACAGCAGTCAGGCTGTGCAAGCTGTCCGTGATGCTGGCTATGAAATATCTCTGGGTTTGATGCCCAAGTCAATAGGGCCCTTAACATTTGTGTTCACAGGGACTGGCAATGTATCAAAGGGAGCCCAAGAAGTCTTCAATGAACTACCCTGTGAATATGTGGAACCACATGAATTAAAAGAAGTTTCTAAAACTGGTGACCTGAGAAAAGTGTATGGAACAGTGTTAAGTCGCCATCATCATCTTGTCAGGAAAACAGATGGTACATATGATCCCGTAGAATATGACAAATATCCTGAGCGCTACATAACTCGTTTTAATACCGATATTGCACCCTATACAACTTGTTTTATTAATGGAATCTACTGGGAGCAAAACACCCCTCGTCTACTAACCCGCCAAGATGCTCAAAGCCTCCTGGCTCCAGTCAAGTCTTCAGTTGTCGGTGTGGAAGGCTGCCCTGCATTGCCACACAAACTTGTGGCAATATGTGACATTTCAGCTGACACAGGAGGGTCTATCGAGTTTATGACCGAGTGTACAACAATAGAGCGTCCTTTTTGCATGTATGATGCAGACCAGCATATTATTCATGACAGTGTTGAAGGCTCTGGGATTCTGATGTGTTCCATTGACAATTTGCCAGCACAGCTTCCAATTGAAGCTACAGAATACTTTGGTGACATGCTTTATCCTTATGTCGAAGAAATGATATTATCAGATGCAACACAGCCTCTTGAAAGTCAGAATTTTTCTCCTGTGGTGAGAGATGCAGTGATTACATCCAACGGTACATTGCCTGATAAGTATAAATATATCCAGAAACTCCGAGAGAGCAGGGAACTTGCTCAGTCACTTTCAATGACTACCAAGAAAAAGGTCTTGGTTCTTGGAAGTGGTTATGTATCTGAGCCTGTACTGGAATATCTGTCGAGAGATGACAACATAGAAATAACAGTAGGCTCTGACATAAAGAATCAAATTGAACAGTTAGGCAAGAAATATAACATTAGTCCTGTTATCATGGACATTGGTAAACAAGAAGAGAAATTGGTCTCCTTGGTGGCAACACAAGATCTTGTCATCAGCTTGTTGCCTTATGTATTGCATCCTCTTGTGGCCAAGGCATGCATCACAAGCAAAGTTAACATGATCACTGCAAGCTATATCACACCAGCACTAAAAGAATTAGAGAAGAGTGTGAAAGATGCTGGCATCACAATCATTGGAGAATTGGGATTGGACCCTGGTCTTGATCACATGTTGGCAATGGAAACAATAGATAAGGCCAAAGAAGTAGGAGCCACGATTGAATCTTATATTTCCTACTGTGGTGGGCTTCCAGCCCCTGAATATTCAGACAATCCTCTGAGATACAAGTTTAGCTGGAGTCCCACGGGAGTCTTGATGAACATAATGCAGCCCGCCACCTACCTCCTCAATGGCAAGGTTGTGAATGTCAAAGGGGGCGTCTCCTTTCTCGATGCGGTTACTCCCATGGATTATTACCCCGGACTAAATTTGGAAGGCTACCCTAACAGAGACAGCACCAAATACGCTGAGGTTTATGGCATTCCCTCTGCTCACACGTTGTTGCGGGGTACACTGAGATATAAGGGATATGCCAAAGCCTTGAATGGGTTTGTGAAATTGGGTCTTATAAACAGAGATGCATTTCCTGCCCTTAGACCTGAAGCCAAGCCTCTCACCTGGAAAGAGCTCCTCTGTGATCTAGTTGGGATTTCACCCTCCTCCAAGTCCGATGTGCTCAAGGAAGCCGTCCTTAAGAAACTAGGAGGGGACAATACCCAGCTGGAGGCTGCTGTATGGTTGGGCTTGCTTGGGAATGATCAGGTCCCTCGGGCAGAGTCTGTTGTGGAAGCGCTCTCCAAGCATTTAGCCACAAAACTTTCGTACGGTCCCGGAGAGAAAGATATGATTGTGATGAGAGACAGCTTTGGAATCAGACATCCTTCTGGACATTTAGAAAG