Transcript asmbl_22951

Sequence
Transcript Sequence for observation asmbl_22951 of TGE0004232:
GACACTGTAGCCTCAGTCGAGAATCACTCAGATTCACTATCCACTGGTGAACAGGCGGATCCAGCCATAGCCAAACCAAGCATCGTAACAACCAGTGATACGGTCAGTGCAAACACAAAGATGGCACCCAGCGACTCGGAAAAATCGGGGATACCAGCCTCAGACAAGAATATTGCCATTGCTACTGGCTCAAAGACGACTCAAGATCCAGCTCAGAAGTCTATTACACCAACTACTGTCCTGATGAAGACCGAAACCAAAAGCAGCCAGGATGGACTTAAAACTGCACCTGGAACGAAAGTCCAAAGTAGTCCCAGTGTTACTGCGAGCATGACCACGCAGGGAGGTCGCACGGACCTCCAATCTACACAACATCTGAGTAGCTCCACAGACAACAGTCCTGCCCTTTCTTCCTTGACCACCCCAGCGAGCACACAACAGCTGACTCCAGGCTCTCCCAAGGGACCAGACCAAATGACGACAGCTTCAAGTAGTTCAGGCACAACGGCAGGTTACACCTTCACCCCTTCACATCCGAGGACGGCTACCACACTGAGATCATCGATTACCTCGCAAGATCTGCCGACCCCCAGCAAGATGCCAGCCATCACTGGGAACCATTCCTCCACCCCGGGGACCCCTTCCTCCATCCCTGGGATAGCGACTTCTTTGTCCAACACTCTGCAGCCTACGTCTTCATCGGGACCTGTGGCCACATCTTCTGGCGGAACCACAAGCTTCCGTACTCAGTTGGCTCCAACTGCCCCCCAAGACTCCAACATCTCTACTCCCCCCTCGGTTTTCGAGGATGACAGGATAACCTGCACGAAGACCGACCGAAGTCTGAACGAGTCGATGCTCATCTTGAACCTCACGAAAACCGTCCACTGCGCGGGGAGCCCTCTGGATGACAAACTGGTCACACTTCTGTGCCGAGCGGCTAAATCTGCCTTGAACCCAACTCAAGACCAGTGCCACATACATCTGATAGTCAGTTCAGAAGGCCAGGCAGTGGCAGTCGAAGAGATCACTATTCGAACAAAACTCGTTCTTAAGGACGTATATGAATCGCTGAAAGACAAATGGGATGACCTGAAGGAGATGGGAGTCAATGACATGAAGCTTGAGGGTCAAGGACCACCAGATGAGACTGAGGACCGGTTCAGCAAAAAATATTGTCTGCATGGCATCCTTTCTGCTCCTCGTGGCGGCCCTCTATGGCTGCTGCCACCAGCGCCTCTCCCAGAGGAAGGACCAGCAACGACTAACGGAGGAGCTGCAGACCGTGGAGAATGGTTACCATGACAACCCAACACTGGAAGTGATGGAGACCTCATCAGAGATGCAGGAGAAAAAGGTGGTCAACCTTAACGGGGAGCTGGGAGACAGCTGGATCGTCCCCCTGGACAACCTGACCAAGGATGACCTAGATGAGGAGGAAGACACACACCTCTAATCCGGTCTGCTGGCGGCCTCCGACGGTGCCACAGAGCTCCAGACCGGACCACCTCAAGTGCCATTGGGACAGGGGAGGAAAGTCCTTCCCATTTGAGGGAAAGACTGGGGAGGGAGCAGACTTGGAGGGTTCCCTCCTCCTAATCCCGCAAAGGGCCTTAATTTTTCTCTTTCAAACTGAACAAATCATATCCTGTCTAGATTCCTCTTGTAAAATAACCTACTAGTGCCTGAGCTCAGTGCTGCTGGAAGATGAGAGAGAGGAAGGGAAACCAAGAGTGAGCCATACTGGGGACGTAGAGATCAGCTAGTCGAATCCCTTCATTTCACAGATGAGATGACTGAAGCCCGAAGAGGGTAAAGTCAAGGGTGACACAGCCACTTGGTGACAGAGTCAGGATGAAAACAGATTCCTTCCTGCAGGCCAGTGCTCGTTCCACCCTGCCACACTGCTGCGATCCCTCGTGCCCTCCCTCCAGAGCTGCCCCGGGCTGGGGGTGGAGCTGCCAGATGATGGATGGGACAGAAGGGAGAGCAGCGGGGCCCGATCCTGCCTCAGCGGGATCTGGTTCCTTGAAAGCATAGGTCCCAGTTCTGTCTCCTACCCCAGCCTCGTCTGCCATTGTTCTCGTCCCCTTTGTTCTTCCCCTTCCATTCACTCGATTTTTATTCCCATTCTGCCCCAGGATCTTGAGACTAACACAGGTCATTCATGACCTTGAACCCCTTGTCTGGATTCTGGTTTCCTGCCATTTGCTTAGTGAGACTGGGACTTGGACCACACGAGACTCCCAGCGTGAACGAGGTCTGCTTAGGGGTCCGTCTACAGGTGGAGAGCTGGGGAAGCCCTTCCTCCCCGGGTGTGTCCTGGCCCATCACCCAAGGGACTCCCTGAAGAGGCTTCCCAAGTGTTCCATTGGCCTCTCTTCCCCACCAGGGGCTAAATTCCACAGCTAATGAAGGCAAAGGGTTCCTATACTGTTGTTCACTGCTCAGCCAACGGGGGTGAAAATCCCAGCTAGGAAACCCCAAGATTAGCGCGAATGGGCGGCATTCGGACAGACTTTCCCAGGGCCCCAGTCAGCAGAGAGGGCGTCTTGACAGACAATCGAAGGAAGGCCGGGGAGGCTAGGCTCTTCTATTTCATAGGAAACTCAGGGACTTTTCAAGTTGCTGAGAGTTTTGTTATGTTTTCTAACCCAGCCCTCTACTGCCTAAGGCCAAAGCTCAAATTGTAGAGACTTTCAGTGAGCTAAACTCACTGATTAGAGTCTCCTGTGCCATAGGGCAAGAGAGGCCTAGAACATGAGGTGCATTTTAAGGTGCATAACGGGCAGCCCGGGGGCATGGCCGTCTGTCTGTTCTCGGTAACCCCTCACTGTCCTGGCATGGAGCCATGTCCTCTTCTCTGTAGTCCTAGTGGGGCTGCCCTGTTGTCCTGCAGTTTCTGGTAGCATCTCAGGGAAATAAAATACTATCTGTTCCTCAGTAGAGGAGATCTGAGGGGCTCAGCAGTTAGCCACCATGTAGGAAGACTAGGCGTGGTGAGGTTTAATCTGATTTTCTGACGAGAGAATCCTGTGTGGGATTTTGAACTTTGCCCATGGTCACTATTGTTCCTGGGCGTAAGATCCCTGGAATTAACTAGGAAGATGGGCAGCACTGCTTAGGAGAGTGAAAACTGTCATTTCGGGCCAAGAGTCAGAACCCCAGAATGCAGAGGGATGGTTCTGATGACATAGGCTCTCAGATTTGGGATAGATTCTTTTATTAAAAGGGGAGGAGTTTAAGGGGAAGATCTGTGTCCCTCCGTGGCTGCCTGATTCCTTCTTCATAGCTTCTCGCCCGTTGGCTTTGGGGTTCAAGTAGGGGCCCCAGTGAATTTCTCAAGAGTTAGAGAGATACAAAGCTAACAAGGATCCAAAAGCATTCGCCCTGGTTCTCTAGCATGTGGAGGTTGGCAGGATGGAGAACAGTGCCAGTTTGGGGGAAAAGGAAGGATATCTTGTCATGTTGGGAAAAGATCTGGTCACTTCCTTCCTGTCCCGTATTTGGTTCTTTCTATCATGGTGTCTGTGGGAAAGGCCAGGCCGGATTACGGCTCCTATGCTGATTCTGCGTAACATTTCACCAGCCAGGCCTTGAGACCGAGGTAGCAAATATGCCTCTGCAAACTGATCAAAGGTCGCAACCTGTAGGCCTCTTGGGGAGATAGACAATGCCTGGAATGACTGTGGCTCTAAGGAGACCTCTGAGAAGCACTGGGCTGGTTCAGAGGTTCCTTCTTGAGGTCCATCCACATTGTGTTACTCTAGCTTTTTAGGGCAACTTCAGAATCCAATACCTTGCCTCGGCTTGTTCTTGCCACTAGACATCTATGTCAAAGGCCACAGAGCCATGCATCTGCAAAGGACATCTTCTTCCCATCTTTCTACTGGTTTCTAAATGCTGTCAGGTAATTCAGATTCTGGGGCTGAGAAGAGAGAAGAGGAATACCGGCCACTCAGCATGACTTTGAACAAGTTATACCAAAGAGATGATAAACTCTTTACTTCAGTGACACACTGGTTTTCCTAAGCTGCACAAAAGGCTAGAAACCATGCCTCTGATGACTGGACAAAATCCAGTGGGAAACATGCTGTCATAAGCGGGGGGAGAAGCAGCAATGCTTACGAAGGAGGCACAGAAATATGCTTTGCATCGTAAGACAGGATACGGGTTTAATCTAGACACAAGGTTCTTTTTCCCCCCTTTGGTAAGGAAAGTTGGCAGAAAGTTCATTTAAACCACTTCCAAGATTTATCCTTTTTGACAATATGCTGGAGAAACTTTGAAAAATAAGTTCGAGCTGATACATATATACGTATTTTTTGATAATGTAAATAAAAGTCACATATTAATCCACCCTGTACTGCTTTAAGTGAATATACTTTGGAAAAACATTTGTTAGCTAAGAGAGATGGCTTTAAAAACAAAAACAAAACAGGAATGTAAATGTCTATTTTACTAGAAATGACAAGTTTTTTTATTTTTCTTTAATGAAAAACGAAATTTAAGATAGGCTGATGACAAAGTATTTGTCTTGAGTAATGGGCATTTTTAAGTATGATCCTCATCCTTCCCCGGCAAAGTCCCAGCCTATTATAGTAAGGGTTGGAGTCAGTATACACTCATTGGAAAGTGACATTCTAGTCATAGGGAGAGGGTGTTAGAGACCTAGTCCAATATTTTTCTTTAAAGAGAAAACCTGAAGCCCAGAAAGATAAGTGACTTGGCCAAAATCATGTGGTTAGCGACAGAAACCGGATTAAAACATGTGCTGGAAGACTGTCCAGTGTCGTGTGCCTCAGAACCAAATTAAAGACAGGCACCAGAATGACACAGAGGGCTGAATTCCCTTCTCAAATCCTATCTTGCAGCAAGGCTAGGGAGGGCATGAAGACAAAAACAGAAACCTTACTGGTCTTCCACATTCTGAGTTATTTAGGTCTAAGACTTAAATGAACAATTCTGTTGGGGGAAAAAGAAAGTTTTGAATGAGCTTTTATATGATCTGCTACTAGCAGGACTAAGGATCCAGAGGAACAAGACAGGGGAAGGCAGAGGGACAAGAGTAAAGCAAAGGCATCTCTTTCATCATTGTCACCAGCTGATTCACTGAGGTTTGGTGAAAACCCAACACTGGGTGAAAGAAGGCGATTATCACTTGATGTGGGTCTTTTCTGTTATTCGTGAATTTTAAGCAGTTTGCCCAGGAGACTGGGGTGGG