Transcript asmbl_22676

Sequence
Transcript Sequence for observation asmbl_22676 of TGE0001355:
CCCGCCCCTCGGCTCGGTGGTAGGCTGAGACGGGAGGGTCCTCGGCTAAAGCCCAAAGCGGATCAAAGTGGTGGGACTCGCGCCGCGGCCGCGGAGACGTGAAGGCCCTCCGCACGCTCCTCCCGATCCCGGTCGGTGCTCGCCCTCGCTGTGCTCCCAGTCCCCATGGAGAAGACGGAGCTGATCCAGAAGGCGAAGCTGGCCGAGCAGGCCGAGCGCTACGACGACATGGCCACCTGCATGAAGGCCGTGACGGAGCAGGGCGCCGAGCTGTCCAACGAGGAGCGCAACCTGCTCTCGGTGGCCTACAAGAACGTGGTAGGGGGCCGCAGGTCCGCCTGGAGGGTCATCTCGAGCATCGAGCAGAAAACCGACACCTCCGACAAGAAGTTGCAGCTGATTAAGGACTATCGGGAGAAAGTGGAGTCGGAGCTGCGGTCCATCTGCACCACCGTCCTGGAATTGTTGGATAAATATTTAATAGCCAATGCAACTAATCCAGAGAGTAAGGTCTTCTATCTGAAAATGAAGGGAGATTACTTCCGGTACCTTGCAGAAGTTGCATGTGGTGATGATCGAAAACAAACGATAGATAATTCCCAAGGAGCTTACCAAGAGGCTTTTGATATAAGCAAGAAAGAGATGCAGCCCACACACCCAATTCGTCTGGGGCTGGCTCTTAACTTTTCTGTATTTTACTATGAGATCCTTAATAACCCAGAGCTTGCCTGCACACTGGCTAAAACGGCTTTCGATGAGGCTATTGCAGAACTTGATACACTGAATGAAGACTCTTACAAAGACAGCACCCTCATCATGCAGTTGCTTAGAGACAACCTAACATTGTGGACATCAGACAGTGCAGGAGAAGAATGCGATGCGGCAGAAGGGGCAGAAAACTAACTGCACGCAGGATGTCGTCCTTCTTCCCTCCAGAAACCTTTTTACACATCTCTGTTCCTTATTCCATTCGGATTTCCTATAGCGAAGAAACGCATTCATGTGTATGGAATCAACTGTTTATAGTCTTTTCACACTGCAGCTTTGGGAAAACTCCATTCCTTGATTTGTGTTTGTCTTGGCCTTCCCGGTGTGCAGTTACTGCTGTAGAAAAGTATTAATAGCTTCATTTCATATGAACATAAGTAACTTCCAAACACTTACATAGAGGACTAAAAATGTATCTGGTATTTAAGTAATCTGAACCAGTTCTGCAAGTGACTGTGTTTTGTATTACTGTGAAGATATGAAAATGTAGTTAATTACAGTTTAAAGAGTGTTCTACATAACTTCTTAATTTCTACATTCCCTCCCTTACTCTTTTTTTGGGGGTTTCCTTTCAGTAAAAACTTTTCCATGTTCTTAATGTATTCCTTTTTGGTAGGAATTCAGAAGTATTAGATTGAATGGAAAAGCATTTGACATTTCCGGGCTGGGGGTCACAAATTAAAATGCCTCCTGTATCACATACAATGGGGTTCCTGTGTATCTGTGACAACAGGGAGTTTCCTTATTCACTCTTCATTTGCTGCTGTTTCAGTTGACAACTTCCCTTCCCAATAAAAATTCACTTACGCCTCCCGCCTTTGTAGTTCTGGTATTCACTTTACTATGTAATAGAAGTAGCATGTTGCTGCCAGAATACAAGCCTTGCTTTTGGCAAATTAAAGTGCATGTCATTTCTTAATACACTAGAAAGGGGAAATAAATTAAGTACACAAGTCCAAGTCTAAAACTTTAGTACTTTTCCATGCAGATTTGTGCACATGTGAGAGGGTGTCCAGTTTGTCTAGTGATTGTTATTTAGAGAGTTGGACCACTATTGTGTGTTGCTAATCATTGACTGTAGTCCCAAAAAAGCCTTGTGAAAATGTTATGCCCTATGTAACAGCAGAGTAACATAAAATAAAATTACATTTTATAAACCATTTACTATGGCTTTGTAACAATTGCATACTCATATTTTAAGGGACAAGTGAATTTACTACTTTCTGAAGTTTATTGATACTTCCCTTTTATGTAAAATGTAGTGATGCCCATATTTCTGCATTGTAATACACTTGTCTAGGGATGTCTGGAAATGTATAAAATTGGCCTACGTTTCTTAGAGTTAGTGTTTTATTCACAGATCGGTTTTGTGGGCCATCTCTTTCTCAGATGTAAATGATACCTAGTTAAGTGTTATATGGAATAAAGTGGACATTTTAAAACTAGAAAA