Transcript asmbl_31373

Sequence
Transcript Sequence for observation asmbl_31373 of TGE0001362:
CGTCACCTGAGGGGGGCACTTCCGGTCTCGTGCCGCCTTCCCAGGACCCTCAGGGAGAGCGGGCAGCCTTCCAGGTGGACAGGTAACCCAGGTTTTTCTGCCTTTTATGTGCCATTTGCAAAGGCTTTATACTCTTTGACAAACAGACGCTTTCCAGTTTGGACTATCAGTCATGCTGGGCATGCGTTGGCTCCCAAAGACAAGAAGATTCTTACAACATCAGAGGATTCAAACGCTCAAGAAATTAAGGACATTTATGGACTAAATGGACAAATAGAGCACAAACTAGCTTTCCTGAGAACTCATGTGCCAAAGGACATGAAACTTGTGCTCATTGGCCATTCAATAGGCAGCTATTTCACACTTCAGATGCTGAAGCGAGTCCCTGAGCTCCCGGTAATTCGTGCCTTTCTGCTCTTTCCAACAATTGAACGAATGTCTGAGTCACCCAATGGCAGAATTGCCACTCCACTTTTGTGCTGGTTTCGATATGTTCTCTATGTTACTGGCTACTTATTATTGAAACCGTGTCCTGAGACAATCAAGTCCTTGCTAATCAGAAGGGGCCTTCAAGTAATGAACCTAGAGAATGAATTTTCACCATTGAATATATTAGAACCATTCTGCCTTGCTAATGCTGCCTACCTTGGGGGCCAAGAAATGATGGAGGTGGTGAAGAGAGATGACGAAACCATAAAGGAGCATTTATGTAAGCTTACATTTTATTATGGTACTATAGATCCTTGGTGTCCAAAAGAGTACTATGAAGACATTAAGAAGGATTTTCCAGAAGGAGACATTCGACTCTGTGAGAAAAACATACCTCATGCTTTCATCACCCATTTTAACCAGGAAATGGCAGACATGATTGCTGACTCCCTAAAGGATGACTTGTCCAAAATGTAAATTGGCCTGAGGAACAAGCCCCCACTGCCAGTACATGGAGGCAGTCAGTGTACTAGACTTAGTAGGTAAATGTTTAATTTTGAAGACTGATATTAGAAATGAAGAAAGTGAGAACCTTTGTCTTACAAACCAACTCTCCGCTCGCCATGTTATAGGCTGAAGTAAACACAGTTGATGAATCATTCCATAGGTTTAACCATACATTTTCCAAGACTCAGGG