Transcript asmbl_21827

Sequence
Transcript Sequence for observation asmbl_21827 of TGE0004161:
GTCGCAGGGCCCAACATCTGTACCACACGCGGTGTGAGCTCCTGCCAGCAGTGCCTGGCCGTGAGTCCCATGTGTGCCTGGTGCTCAGATGAGGCCCTGCCTCTGGGCTCTCCCCGCTGCAACCTGAAGGAGAATCTGCTGACGGATAACTGTGCCCTGGAGTCCATCGAGTTCCCCATCAGTGAGGCCAGCATCCTGGAGGCCAGACCCCTCAGTGACAAGGGCTCTGGAGACAGCTCTCAGATTACTCAAGTCAGTCCCCAGAGGATTGCGCTCCGGCTCCGGCCAGATGATTCGAAGAGTTTCTCCGTCCAGGTCCGGCAGGTGGAGGATTACCCTGTGGATATCTACTACTTGATGGACCTGTCTTACTCCATGAAAGATGACCTGTGGAGCATCCAGAACCTGGGTACCAAGCTGGCTTCCCAGATGCGCAAGCTCACCAGTAACTTACGGATTGGCTTTGGGGCCTTTGTGGACAAACCCGTGTCACCATACATGTACATCTCCCCACCAGAGGCCCTCAAAAACCCCTGCTATGATATGAAGACCACCTGTTTGCCCATGTTCGGCTACAAACATGTGCTCACACTGACTGACCAGGTGACCCGCTTCAATGAGGAGGTGAAGAAGCAGAGTGTGTCACGGAACCGAGATGGCCCAGAGGGCGGCTTTGATGCCATCATGCAGGCGACAGTCTGTGATGAGAAGATTGGCTGGAGGAATGATGCATCCCACTTGCTGGTGTTTACCACTGATGCCAAGACCCATATAGCACTGGATGGAAGGTTGGCAGGCATTGTCCAGCCCAATGATGGGCAGTGTCACGTTGGCAGTGACAACCATTACTCTGCCTCTACTACCATGGATTATCCCTCTCTGGGGCTGATGACTGAGAAGTTATCCCAGAAAAACATCAATTTGATCTTTGCAGTGACTGAAGAAGTAGTCAATCTCTACCAGAACTACAGTGAGCTCATCCCAGGGACCACAGTGGGAGTTCTGTCCACCGATTCCAGCAATGTCCTACAGCTCATTGTTGATGCTTATGGGAAAATCCGCTCCAAAGTAGAGCTGGAAGTGCGTGACCTTCCTGAGGAGTTGTCTCTGTCCTTCAATGCTACTTGTCTCAACAACGAGGTCATCCCAGGCCTCAAGTCTTGTGTTGGACTCAAGATTGGAGACACGGTGAGCTTCAGCATCGAGGCCAAGGTGCGTGGCTGCCCCCAGGAGAAGGAAAAGTCCTTCGCCATCAAGCCTGTGGGCTTTAAAGACAGTCTCACTGTGCAGGTCACCTTCGACTGTGACTGTGCCTGCCAGGCCCATGCCGAGCCTTACAGCCGCCACTGCAACAACGGCAATGGGACCTTTGAGTGTGGGGTGTGCCGCTGTGGGCCTGGCTGGCTGGGATCCCAGTGTGAGTGCTCAGAAGAGGACTACCGCCCCTCGCAGCAGGATGAGTGCAGCCCCCAAGAGGGCCAGCCAGTCTGCAGCCAGCGGGGCGAGTGCCTCTGTGGCCAGTGCGTCTGCCACAGCAGTGACTTTGGCAAGATCACGGGCAAGTACTGTGAGTGTGATGACTTCTCCTGTGTCCGCTACAAGGGGGAGATGTGCTCGGGACATGGCCAGTGCAGCTGTGGGGACTGCCTGTGTGACTCCGATTGGACCGGCTACTACTGCAACTGTACCACACGCACGGACACCTGCATGTCCAGTAATGGGCTGCTGTGCAGCGGCCGGGGCAAGTGTGAATGTGGCAGCTGCATCTGCATCCAGCCAGGCTCCTACGGGAACACCTGTGAGAAGTGTCCCACCTGCCCTGATGCCTGCACCTTTAAGAAGGAGTGTGTAGAGTGTAAGAAGTTCAACCGGGGAACCCTGCTCGAGGAAAATACCTGCAACAGTTACTGTCGTGATGAGATCGAGTCTGTGAAGGAGCTCAAGGACACTGGCAAGGATGCAGTGAATTGTACCTATAAGAATGAGGATGACTGTGTCATCAGGTTCCAGTACTATGAAGACTCCAGTGGAAAGTCTATCCTATATGTGGTAGAAGAGCCAGAGTGTCCCAAGGGCCCCGACATCCTAGTGGTCCTGCTTTCAGTGATGGGGGCCATTCTGCTCATCGGCCTTGCTACTCTGCTCATCTGGAAGCTCCTCATTACCATTCATGATCGGAAGGAATTTGCAAAATTTGAGGAAGAGCGAGCCAGAGCAAAATGGGACACGGCCAACAACCCACTGTATAAAGAAGCCACATCCACCTTCACCAACATCACCTACCGGGGCACTTAATGGCAAAGTAGTCGTCCTCCGATCACTATCAGACTGTCCCAGGATTGTGGGCATCTCTGCTGTCGTGTTTACAGGAGACAATATCTGTGGGGTGGGATT