Transcript asmbl_21163

Sequence
Transcript Sequence for observation asmbl_21163 of TGE0004149:
TTTTGTTCTTCTCGTGGTTCCAGTGGGGAGAGAAGGAGGAAGCAGGGTGCGGGGCGGTCGGGGGGGGACCCGCCGCGGCTGTTGCCACCGCCGCCACCACCGCCTCTGTGCTCGTGGCGTGGGAAAGGAGGCGTGAGTCCCGGGCGCGAGCCGCCGGCGGCGCCGCTACGGGAGGATCGGTGGTGGGAAGGCGATGGCGGATATAGATAAACTCAATATCGACAGCATCATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCTGGTAAGAATGTCCAGCTACAGGAGAATGAAATCAGAGGATTGTGCTTAAAGTCCCGAGAGATCTTTCTCAGTCAGCCTATCCTACTAGAACTTGAAGCACCACTCAAAATATGTGGTGATATCCATGGGCAGTACTATGATTTGCTTCGACTTTTTGAGTACGGTGGTTTCCCACCCGAAAGCAACTACCTGTTTCTTGGGGACTATGTGGACAGGGGGAAGCAGTCATTGGAGACTATCTGCCTTTTATTGGCGTACAAAATCAAATATCCCGAGAATTTTTTTCTTCTCAGAGGAAACCATGAATGTGCCAGCATCAATAGAATTTATGGATTTTACGATGAATGTAAAAGAAGATATAACATTAAACTATGGAAAACTTTCACAGACTGCTTTAATTGTTTACCAATAGCAGCCATCGTGGATGAGAAAATATTTTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGCGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGATATGAATTTTTTGCAAAGAGGCAGTTGGTCACTCTGTTTTCTGCACCCAATTATTGTGGAGAGTTTGACAATGCAGGTGCCATGATGAGTGTGGACGAAACACTAATGTGTTCTTTTCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCGAATGCCACAAGACCTGTAACACCTCCAAGGGGTATGATCACAAAGCAAGCAAAGAAATAGATGTCATTTTGACACTGCCTAGTTGGGACTTGTAACATATAGTATATAACCTTCATTTTTAAAACTGTAATGTGTATTGGTCAGCTTGCTCAAACAGTGTGTTTGTGGGGCCCTCCCTTCCATTTTTGACTTAATGAATGGCATTTGCTGGTTATAACAGCAAATGAAAGATTCTCTACTCCCAAGAAACAATATTTTGTTTTTAATTCTCTATTCCTTTTACAAACAATTTTAATGATGGTGTTAAAGCTGTATGCCCCAGGATGGTTTATCCTGTCTGAGGGGTAAGTGTACAATTGACCTTTTTTTTTTAATTCAGTACAGCCCATGAATCATGTAAATGCTCGTTTTCTTTAGGATATAAAGAGAGCCCTAGGGTGCTCAATCTGTACATGTTATCGTCATAAAATGCATACTGTTGATACAGACCACTGTGAACATTTTTTTAATTTTAAGATTTTGTTTCAAAGGGATTGCTTATTTCTCTCATTGTCTTGTCATGTACAAATTGGTTTTTATTGCTATCAACATTAGAAGTAACTTTCAACCTTGCCAGCATCACTGGTATAATGTATGTTTAATTAAAGCACACTTTCCTCTACCGAATACTTAAAACGAGAATTAAAGCCATTATTTTAAATGTTTGTGACTCTTTCCTAAAGCCAAAGTTTCTGTTGAAATACGTATTGACACACCCCTAAGAACAAAATGGCATAGTTTTATACCCATGCCGCCTTGTTGGGGATTCAAAAACAGGTTTTTGAGTTAAAATAGCAATTAGTAATATAGTGCAGTTTAAGCTATTAATGATTAAAGTTAATAACATTTTGTACAATTTCCATATAGTCTATTCATTAATCTTTTTACAGTTGCATCAGGCCTGAACCCGTCCATTCAGAAAGCTTCAAATTATAGAAACAATACTGTTCTATACGAGTGACCGATTATGCTTTCTTTGGCCTACACTCTTTATTCTGCGGTGAAATTGAGGCTTATAAGTCAAACAAAGGAACTAACTTACTATCCACCAGTTTATACAGAACTCACAGTATCTATGACTTTTTTAAAACTAAGATCTGTTAAAAAGAAATCTGTTTCAACAGATGACCGTGTATAATACCATGTGGTGAAAGTGAATTCAGACTTATTAAATGATGAACTTGTTAAATCCTCTCAGTGTCTATTTATCAGCACAATACACACAGGAGAACTGTTGATGGCATATTAAATCGATTTTAATGAATAAATGGCTCTGGAAACCACACAGTTTCAATTTGGGTTTGTCTTCCTTCAAATAGTCTGTTTTCCAAAGATGGATCGTAATGTGGATGCTCATATTCTTTGAGTTCCG