Transcript asmbl_31337

Sequence
Transcript Sequence for observation asmbl_31337 of TGE0001358:
CCGTCTGTTCCCCGCCGCTCCCGGCAGGGCCGGGCCGGGCTGGGCCGGGCTGGGCCGGGCGGGCCCCTGGGAGCAGCCCCCAGGCGGGGGACCGCCTTGGAGACCCGAAGCCGGAGCTAGAGGCAGGCGGTGGGCCCGGGTGGAGTCCCGGCCGGAGCTGGTGGTTCGGGGGCGGTGCTAGGCCCCGAGGCTGCGGGACCTGAGCGCGAGGAGCCTGAGTGCGGGTCCAGCGGTGGCGGCATGAGCCGGCCCCCGCCGACGGGGAAAATGCCCGGCGCCCCCGAGACCGCGCCGGGGGACGGGGCAGGCGCGAGCCGCCAGAGGAAGCTGGAGGCGCTGATCCGAGACCCTCGCTCCCCCATCAACGTGGAGAGCTTGCTGGATGGCTTAAATTCCTTGGTCCTTGATTTAGATTTTCCTGCTTTGAGGAAAAACAAGAACATAGATAATTTCTTAAATAGATATGAGAAAATTGTGAAAAAAATCAGAGGTCTACAGATGAAGGCAGAAGACTATGATGTTGTAAAAGTTATTGGAAGAGGTGCTTTTGGTGAAGTGCAGTTGGTTCGTCACAAGGCATCGCAGAAGGTTTATGCTATGAAGCTTCTTAGTAAGTTTGAAATGATAAAAAGATCAGATTCTGCCTTTTTTTGGGAAGAAAGAGATATTATGGCCTTTGCCAATAGCCCCTGGGTGGTTCAGCTTTTTTATGCCTTTCAAGATGATAGGTATCTGTACATGGTAATGGAGTACATGCCTGGTGGAGACCTTGTAAACCTTATGAGTAATTATGATGTGCCTGAAAAATGGGCCAAATTTTACACTGCTGAAGTTGTTCTTGCTCTGGATGCAATACACTCCATGGGTTTAATACACAGAGATGTGAAGCCTGACAACATGCTCTTGGATAAACATGGACATCTAAAATTAGCAGATTTTGGCACGTGTATGAAGATGGATGAAACAGGCATGGTACATTGTGATACAGCAGTTGGAACACCGGATTATATATCACCTGAGGTTCTGAAATCACAAGGGGGTGATGGTTTCTATGGGCGAGAATGTGATTGGTGGTCTGTAGGTGTTTTCCTTTATGAGATGCTAGTGGGGGATACTCCATTTTATGCGGATTCACTTGTAGGAACATATAGCAAAATTATGGATCATAAGAATTCACTGTGTTTCCCTGAAGATGCAGAAATTTCCAAACATGCAAAGAATCTCATCTGTGCTTTCTTAACAGATAGGGAGGTACGACTTGGGAGAAATGGGGTGGAAGAAATCAGACAGCATCCTTTCTTTAAGAATGATCAGTGGCATTGGGATAACATAAGAGAAACGGCAGCTCCTGTAGTACCTGAACTCAGCAGTGACATAGACAGCAGCAATTTCGATGACATTGAAGATGACAAAGGAGATGTAGAAACCTTCCCAATTCCTAAAGCTTTTGTTGGAAATCAGCTGCCTTTCATCGGATTTACCTACTATAGAGAAAATTTATTATTAAGTGACTCTCCATCTTGTAGAGAAACTGATTCCATACAATCAAGGAAAAATGAAGAAAGTCAAGAGATTCAGAAAAAACTGTATACATTAGAAGAACATCTTAGCAATGAGATGCAAGCCAAAGAGGAACTGGAACAGAAGTGCAAATCTGTTAATACTCGCCTAGAAAAAACAGCAAAGGAGCTAGAAGAGGAGATTACCTTACGGAAAAGTGTGGAATCAGCATTAAGACAGTTAGAAAGAGAAAAGGCGCTTCTTCAGCACAAAAATGCAGAATATCAGAGGAAAGCTGATCATGAAGCAGACAAAAAACGAAATTTGGAAAATGATGTTAACAGCTTAAAAGATCAACTTGAAGATTTGAAAAAAAGAAATCAAAACTCTCAAATATCCACTGAGAAAGTGAATCAACTCCAGAGACAACTGGATGAAACCAATGCTTTACTGCGAACAGAGTCTGATACTGCAGCCCGGTTAAGGAAAACCCAGGCAGAAAGTTCAAAACAGATTCAGCAGCTGGAATCTAACAATAGAGATCTACAAGATAAAAACTGCCTGCTGGAGACTGCCAAGTTAAAACTTGAAAAGGAATTTATCAATCTTCAGTCAGCTCTAGAATCTGAAAGGAGGGATCGAACCCATGGATCAGAGATAATTAATGATTTACAAGGTAGAATATGTGGCCTAGAAGAAGATTTAAAGAACGGCAAAATCTTACTAGCGAAAGTAGAACTGGAGAAGAGACAACTTCAGGAGAGATTTACTGATTTGGAAAAGGAAAAAAGCAACATGGAAATAGATATGACATACCAACTAAAAGTTATACAGCAGAGCCTAGAACAAGAAGAAGCTGAACATAAGGCCACAAAGGCACGACTAGCAGATAAAAATAAGATCTATGAGTCCATCGAAGAAGCCAAATCAGAAGCCATGAAAGAAATGGAGAAGAAGCTCTTGGAGGAAAGAACTTTAAAACAGAAAGTGGAGAACCTATTGCTAGAAGCTGAGAAAAGATGTTCTCTATTAGACTGTGACCTCAAACAGTCACAGCAGAAAATAAATGAGCTCCTTAAACAGAAAGATGTGCTAAATGAGGATGTTAGAAACCTGACATTAAAAATAGAGCAAGAAACTCAGAAGCGCTGCCTTACACAAAATGACCTGAAGATGCAAACACAACAGGTTAACACACTAAAAATGTCAGAAAAGCAGTTAAAGCAAGAAAATAACCATCTCATGGAAATGAAAATGAACTTGGAAAAACAAAATGCTGAACTTCGAAAAGAACGTCAGGATGCAGATGGGCAAATGAAAGAGCTCCAGGATCAGCTCGAAGCAGAACAGTATTTCTCAACCCTTTATAAAACACAAGTTAGGGAGCTTAAAGAAGAATGTGAAGAAAAGACCAAACTTGGTAAAGAATTGCAGCAGAAGAAACAGGAATTACAGGATGAACGGGACTCTTTGGCTGCCCAACTGGAGATCACCTTGACCAAAGCAGATTCTGAGCAACTGGCTCGTTCAATTGCTGAAGAACAATATTCTGATTTGGAAAAAGAGAAGATCATGAAAGAGCTGGAGATCAAAGAGATGATGGCTAGACACAAACAGGAACTTACGGAAAAAGATGCTACAATTGCTTCTCTTGAGGAAACTAATAGGACACTAACTAGTGATGTTGCCAATCTTGCAAATGAGAAAGAAGAATTAAATAACAAATTGAAAGATGTTCAAGAGCAACTGTCAAGATTGAAAGATGAAGAAATAAGCGCAGCAGCTATTAAAGCACAGTTTGAGAAGCAGCTATTAACAGAAAGAACACTCAAAACTCAAGCTGTGAATAAGTTGGCTGAGATCATGAATCGAAAAGAACCTGTCAAGCGTGGTAATGACACAGATGTGCGGAGAAAAGAGAAGGAGAATAGAAAGCTACATATGGAGCTTAAATCTGAACGTGAGAAATTGACCCAGCAGATGATCAAGTATCAGAAAGAACTGAATGAAATGCAGGCACAAATAGCTGAAGAGAGCCAGATTCGAATTGAACTGCAGATGACATTGGACAGTAAAGACAGTGACATTGAGCAGCTGCGGTCACAACTCCAAGCCTTGCATATTGGTCTGGATAGTTCCAGTATAGGCAGTGGACCAGGGGATGCTGAGGCAGATGATGGGTTTCCAGAATCAAGATTAGAAGGATGGCTTTCATTGCCTGTACGAAACAACACTAAGAAATTTGGATGGGTTAAAAAGTATGTGATTGTAAGCAGTAAGAAGATTCTTTTCTATGACAGTGAACAAGATAAAGAACAATCCAATCCTTACATGGTTTTAGATATAGACAAGTTATTTCATGTCCGACCAGTTACACAGACAGATGTGTATAGAGCAGATGCTAAAGAAATTCCAAGGATATTCCAGATTCTGTATGCCAATGAAGGAGAAAGTAAGAAGGAACAAGAATTTCCAGTGGAGCCAGTTGGAGAAAAATCTAATTATATTTGCCACAAGGGACATGAGTTTATTCCTACTCTTTATCATTTCCCAACCAACTGTGAGGCTTGTATGAAGCCCCTGTGGCACATGTTTAAGCCTCCTCCTGCTTTGGAGTGCCGCCGTTGCCATATTAAGTGTCATAAAGATCATATGGACAAAAAGGAGGAGATTATAGCACCTTGCAAAGTATATTATGATATTTCAACGGCAAAGAATCTGTTATTACTAGCAAATTCTACAGAAGAGCAGCAGAAGTGGGTTAGTCGGTTGGTGAAAAAGATACCTAAAAAGCCCCCAGCTCCAGACCCTTTTGCCCGATCATCTCCTAGAACTTCAATGAAGATACAGCAAAACCAGTCTATTAGACGGCCAAGTCGACAGCTTGCCCCAAACAAACCTAGCTAACTGCCTTCTATGAAAGCAGTCATTATTCAAGGTGATCGTATTCTTCCAGTGAAAACAAGACTGAAATATGATGGCCCAAAATTTATTAAAAAGCTATATTTTCCTGAGAGACTGATACATACACTCATACATATATGTGTTCCCCTTTTCCCTGTAATATAAATTACAAATCTGGGCTCCTTTGAAGCAACAGGTTGAACCAACAATGATTGGTTGATAGACTAAGGATATATGCAACTCTTCCAGACTTTTCCATAAAGCTCTCTCGGCAGTCGCTCACACTACAATGCACACAAGGATTGAGAAGAGTTAAAGGCTAAAGAAAACATCTTTTCTAGCTTCAACAGAGAGGTTTCACCAGCACATTTACCAGAAGAATCTGGGAATGGATTCCACTACAGTGATATTGACTGCATCTTTAAGAAGTGACCATTATACTGTGTATATATATATAAACACACACACATATATATATATATATATA