Transcript asmbl_20992

Sequence
Transcript Sequence for observation asmbl_20992 of TGE0004133:
AGGCGGGAACCACTGTCCCTGGTCAACGTGCGGAAGAGGAGCCTGGAATCTGGAGACGACGACCTGCCGACCAGGATGGACCACTACAAAGCCAAGGCTACGCGGCACATCTTCCTCATCAGGCACTCGCAGTACCACGTGGACGCGTCCCTGGAGAAGGACCGCACTCTGACGCCCCTGGGTCGTGAGCAGGCTGAGTTGACTGGTCTCCGACTTGCAAGCCTGGGGTTGAAGTTTAATAAAATCGTGCATTCCTCCATGACCCGTGCGGTGGAAACCACCGACATCATCAGTAAACACCTGCCAGGTGTCTCCACGGTCAGCACAGACCTGCTGAGGGAAGGTGCCCCCATCGAGCCCGACCCGCCCGTGTCGCACTGGAAGCCGGAGGCTGTGCAGTATTACGAGGACGGGGCCCGGATTGAGGCTGCCTTCCGCAGTTACATCCACCGGGCAGACACCAAGCAGCAGGAGGACAGTTACGAGATCTTCATCTGCCATGCCAACGTCATCCGCTACATCGTGTGCCGGGCGCTGCAGTTCCCTCCGGAAGGCTGGCTCCGTCTCTCCCTCAACAATGGCAGCATCACCCACCTGGTGGTCCGGCCTGATGGCCGAGTGGCACTCAGGGCTCTTGGGGACACGGGCTTCATGCCTCCCGACAAGATTTCCCGCTCCTGAGGCCGCTGCGAGGCCAGTGCCTGGCTCTGCTGCGGGAGCCGGGAACAAGGGCCGTGTCCCCTGCCTTCCGTCCGCAGGTGGCACTGCGGTCGCTGTTTCTCCAGGATGAGGCTGCGGAGTGGAAACACCTGCCACACGGCACATCGTCATCCTCCTGCCCAGAGTGGCAGGGGGCGCTCGGGCCCCGCTGCCGGGTCTCCCCAGGTCCTCTGCCCCAGGCTCACCTACTAGGATGGGCCTGTGGGGGTGGAGGCCCCGCGGGGCCCTGCAGGTGTGCACCGGGGCCTGTGGCCAGGACCGCGACCGCAAGAGGCAGCGAGCCCATCAGGCTGAGGGCGTCAGGAGGGCCCGGCGCTTCCATCCTAATGTCTTTGCTTCGTACGTTCTTTTTGTAAGATCCTCTCGTCACTTATGTTAAAGACTTTCCTCACCTGGGTTCTTTTCTGAAAACCGATTCCTCGCTCCGGAGTTACGCACCCCTGATGCTACTGCATCTGAACTCACGTGTCTTCAAGGCCTTTGCGGACATGGGCACCCAGGCAGGTGGTGGGGGCCAGGGGGAGAGGGTCCTGTTTAAAATATCCAGCTGATGGCTGAATCTTTGTTTGCCTCTAGCTGTTAATCTTTTATGCTTATGGATGAAAACATTTAGACACGACATGTCCATCATAAGTATTCTGTTAATTTACCAAAAACCCTACAATTTCTGCGAAGTGGTTATGGACATTTTCTGCTGTGATCAGTGCAACTGAGATATTTGATCCATTTCTGTTAACTTGGAAATAACTACAAAATAAAGTTTTATTTTACTGGTT